ID: 958600692

View in Genome Browser
Species Human (GRCh38)
Location 3:96293230-96293252
Sequence CCCTCAATGAAATGGATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958600692_958600708 25 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600708 3:96293278-96293300 ATTTGTGAAGGGTGAGGGGCTGG No data
958600692_958600705 19 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600705 3:96293272-96293294 AATGGGATTTGTGAAGGGTGAGG No data
958600692_958600707 21 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600707 3:96293274-96293296 TGGGATTTGTGAAGGGTGAGGGG No data
958600692_958600706 20 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600706 3:96293273-96293295 ATGGGATTTGTGAAGGGTGAGGG No data
958600692_958600700 -9 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600700 3:96293244-96293266 CATTGAGGGGTTCTGGGGAAGGG No data
958600692_958600704 14 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600704 3:96293267-96293289 TTTTTAATGGGATTTGTGAAGGG No data
958600692_958600703 13 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG No data
958600692_958600702 2 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600702 3:96293255-96293277 TCTGGGGAAGGGTTTTTAATGGG No data
958600692_958600699 -10 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600699 3:96293243-96293265 TCATTGAGGGGTTCTGGGGAAGG No data
958600692_958600701 1 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600701 3:96293254-96293276 TTCTGGGGAAGGGTTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958600692 Original CRISPR CCCTCAATGAAATGGATTTG AGG (reversed) Intergenic
No off target data available for this crispr