ID: 958600696

View in Genome Browser
Species Human (GRCh38)
Location 3:96293238-96293260
Sequence CCCAGAACCCCTCAATGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958600696_958600706 12 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600706 3:96293273-96293295 ATGGGATTTGTGAAGGGTGAGGG No data
958600696_958600711 28 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600711 3:96293289-96293311 GTGAGGGGCTGGAAAATTTGGGG 0: 3
1: 2
2: 4
3: 32
4: 233
958600696_958600709 26 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600709 3:96293287-96293309 GGGTGAGGGGCTGGAAAATTTGG 0: 10
1: 16
2: 54
3: 68
4: 375
958600696_958600702 -6 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600702 3:96293255-96293277 TCTGGGGAAGGGTTTTTAATGGG No data
958600696_958600708 17 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600708 3:96293278-96293300 ATTTGTGAAGGGTGAGGGGCTGG No data
958600696_958600703 5 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG No data
958600696_958600701 -7 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600701 3:96293254-96293276 TTCTGGGGAAGGGTTTTTAATGG No data
958600696_958600707 13 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600707 3:96293274-96293296 TGGGATTTGTGAAGGGTGAGGGG No data
958600696_958600710 27 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600710 3:96293288-96293310 GGTGAGGGGCTGGAAAATTTGGG 0: 2
1: 10
2: 27
3: 79
4: 281
958600696_958600704 6 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600704 3:96293267-96293289 TTTTTAATGGGATTTGTGAAGGG No data
958600696_958600705 11 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600705 3:96293272-96293294 AATGGGATTTGTGAAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958600696 Original CRISPR CCCAGAACCCCTCAATGAAA TGG (reversed) Intergenic
No off target data available for this crispr