ID: 958600703

View in Genome Browser
Species Human (GRCh38)
Location 3:96293266-96293288
Sequence GTTTTTAATGGGATTTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958600692_958600703 13 Left 958600692 3:96293230-96293252 CCTCAAATCCATTTCATTGAGGG No data
Right 958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG No data
958600696_958600703 5 Left 958600696 3:96293238-96293260 CCATTTCATTGAGGGGTTCTGGG No data
Right 958600703 3:96293266-96293288 GTTTTTAATGGGATTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958600703 Original CRISPR GTTTTTAATGGGATTTGTGA AGG Intergenic
No off target data available for this crispr