ID: 958600864

View in Genome Browser
Species Human (GRCh38)
Location 3:96295006-96295028
Sequence CTCTTCAGTGCTGCCTACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958600862_958600864 5 Left 958600862 3:96294978-96295000 CCATCTTCCAAAATTGTGTTGAT No data
Right 958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG No data
958600863_958600864 -2 Left 958600863 3:96294985-96295007 CCAAAATTGTGTTGATATCTTCT No data
Right 958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG No data
958600861_958600864 24 Left 958600861 3:96294959-96294981 CCATTTCTCTCATCTATTTCCAT No data
Right 958600864 3:96295006-96295028 CTCTTCAGTGCTGCCTACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958600864 Original CRISPR CTCTTCAGTGCTGCCTACGC TGG Intergenic
No off target data available for this crispr