ID: 958602901 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:96321597-96321619 |
| Sequence | TCTAATATGCAGAGTCTATA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958602900_958602901 | -9 | Left | 958602900 | 3:96321583-96321605 | CCATCTGACAAAGGTCTAATATG | 0: 24 1: 1244 2: 5733 3: 3248 4: 1568 |
||
| Right | 958602901 | 3:96321597-96321619 | TCTAATATGCAGAGTCTATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958602901 | Original CRISPR | TCTAATATGCAGAGTCTATA AGG | Intergenic | ||
| No off target data available for this crispr | |||||