ID: 958602901

View in Genome Browser
Species Human (GRCh38)
Location 3:96321597-96321619
Sequence TCTAATATGCAGAGTCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958602900_958602901 -9 Left 958602900 3:96321583-96321605 CCATCTGACAAAGGTCTAATATG 0: 24
1: 1244
2: 5733
3: 3248
4: 1568
Right 958602901 3:96321597-96321619 TCTAATATGCAGAGTCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958602901 Original CRISPR TCTAATATGCAGAGTCTATA AGG Intergenic
No off target data available for this crispr