ID: 958605933

View in Genome Browser
Species Human (GRCh38)
Location 3:96358474-96358496
Sequence TTGAATAGGAATGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958605925_958605933 30 Left 958605925 3:96358421-96358443 CCTTTATTTCTTTCTCTTGCCTA 0: 201
1: 3010
2: 8263
3: 6745
4: 3815
Right 958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG No data
958605927_958605933 -3 Left 958605927 3:96358454-96358476 CCAGAACTTCCAATACTATGTTG 0: 1942
1: 10957
2: 4419
3: 1703
4: 927
Right 958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG No data
958605926_958605933 11 Left 958605926 3:96358440-96358462 CCTAACTGTTGTGTCCAGAACTT No data
Right 958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958605933 Original CRISPR TTGAATAGGAATGAGGTGGG AGG Intergenic
No off target data available for this crispr