ID: 958606691

View in Genome Browser
Species Human (GRCh38)
Location 3:96367048-96367070
Sequence CTTTGTACATAGAAATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958606691_958606694 23 Left 958606691 3:96367048-96367070 CCATCATATTTCTATGTACAAAG No data
Right 958606694 3:96367094-96367116 GAGCACGTAAAAAAAAAAAGTGG No data
958606691_958606692 0 Left 958606691 3:96367048-96367070 CCATCATATTTCTATGTACAAAG No data
Right 958606692 3:96367071-96367093 AACAGTTAGAATACATACTTCGG No data
958606691_958606693 1 Left 958606691 3:96367048-96367070 CCATCATATTTCTATGTACAAAG No data
Right 958606693 3:96367072-96367094 ACAGTTAGAATACATACTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958606691 Original CRISPR CTTTGTACATAGAAATATGA TGG (reversed) Intergenic
No off target data available for this crispr