ID: 958608736

View in Genome Browser
Species Human (GRCh38)
Location 3:96395582-96395604
Sequence GAGGAAATCAGCCTTGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958608736_958608737 -7 Left 958608736 3:96395582-96395604 CCAGTATCAAGGCTGATTTCCTC No data
Right 958608737 3:96395598-96395620 TTTCCTCTGATGCTTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958608736 Original CRISPR GAGGAAATCAGCCTTGATAC TGG (reversed) Intergenic
No off target data available for this crispr