ID: 958610348

View in Genome Browser
Species Human (GRCh38)
Location 3:96416693-96416715
Sequence TGTCCCAGGAAGCACCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958610348_958610357 28 Left 958610348 3:96416693-96416715 CCATCTAGGTGCTTCCTGGGACA No data
Right 958610357 3:96416744-96416766 CACACAAAAGTGGAATCACTGGG No data
958610348_958610356 27 Left 958610348 3:96416693-96416715 CCATCTAGGTGCTTCCTGGGACA No data
Right 958610356 3:96416743-96416765 TCACACAAAAGTGGAATCACTGG No data
958610348_958610353 4 Left 958610348 3:96416693-96416715 CCATCTAGGTGCTTCCTGGGACA No data
Right 958610353 3:96416720-96416742 GAGGCTGCAGCCACTGGTTGAGG No data
958610348_958610352 -2 Left 958610348 3:96416693-96416715 CCATCTAGGTGCTTCCTGGGACA No data
Right 958610352 3:96416714-96416736 CACTAGGAGGCTGCAGCCACTGG No data
958610348_958610355 18 Left 958610348 3:96416693-96416715 CCATCTAGGTGCTTCCTGGGACA No data
Right 958610355 3:96416734-96416756 TGGTTGAGGTCACACAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958610348 Original CRISPR TGTCCCAGGAAGCACCTAGA TGG (reversed) Intergenic
No off target data available for this crispr