ID: 958616308

View in Genome Browser
Species Human (GRCh38)
Location 3:96497159-96497181
Sequence TTTAATTAGAACTATGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958616308_958616309 -8 Left 958616308 3:96497159-96497181 CCGAGCTCATAGTTCTAATTAAA No data
Right 958616309 3:96497174-96497196 TAATTAAAATTTTACCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958616308 Original CRISPR TTTAATTAGAACTATGAGCT CGG (reversed) Intergenic
No off target data available for this crispr