ID: 958616309

View in Genome Browser
Species Human (GRCh38)
Location 3:96497174-96497196
Sequence TAATTAAAATTTTACCCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958616308_958616309 -8 Left 958616308 3:96497159-96497181 CCGAGCTCATAGTTCTAATTAAA No data
Right 958616309 3:96497174-96497196 TAATTAAAATTTTACCCCTTAGG No data
958616307_958616309 6 Left 958616307 3:96497145-96497167 CCTTTTCATTGAGACCGAGCTCA No data
Right 958616309 3:96497174-96497196 TAATTAAAATTTTACCCCTTAGG No data
958616306_958616309 17 Left 958616306 3:96497134-96497156 CCTAAATGTCACCTTTTCATTGA No data
Right 958616309 3:96497174-96497196 TAATTAAAATTTTACCCCTTAGG No data
958616305_958616309 29 Left 958616305 3:96497122-96497144 CCTACTTCATTTCCTAAATGTCA No data
Right 958616309 3:96497174-96497196 TAATTAAAATTTTACCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958616309 Original CRISPR TAATTAAAATTTTACCCCTT AGG Intergenic
No off target data available for this crispr