ID: 958617754

View in Genome Browser
Species Human (GRCh38)
Location 3:96517162-96517184
Sequence CATCTTAACCAGAGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958617750_958617754 26 Left 958617750 3:96517113-96517135 CCCACAAAAAACAAAAAGCAACA No data
Right 958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG No data
958617751_958617754 25 Left 958617751 3:96517114-96517136 CCACAAAAAACAAAAAGCAACAG No data
Right 958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958617754 Original CRISPR CATCTTAACCAGAGGAAGCT GGG Intergenic
No off target data available for this crispr