ID: 958621320

View in Genome Browser
Species Human (GRCh38)
Location 3:96566313-96566335
Sequence AATCCTGGAGTTGAGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958621320_958621326 11 Left 958621320 3:96566313-96566335 CCACAATGCTCAACTCCAGGATT No data
Right 958621326 3:96566347-96566369 CCTGCCTGCCATGACCAACAAGG 0: 1
1: 0
2: 2
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958621320 Original CRISPR AATCCTGGAGTTGAGCATTG TGG (reversed) Intergenic
No off target data available for this crispr