ID: 958623323 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:96591831-96591853 |
Sequence | ACTTTTATTGCAATTAATGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
958623323_958623328 | 30 | Left | 958623323 | 3:96591831-96591853 | CCACCATTAATTGCAATAAAAGT | No data | ||
Right | 958623328 | 3:96591884-96591906 | CTATTGAAATATAGCCTAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
958623323 | Original CRISPR | ACTTTTATTGCAATTAATGG TGG (reversed) | Intergenic | ||