ID: 958623323 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:96591831-96591853 |
| Sequence | ACTTTTATTGCAATTAATGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958623323_958623328 | 30 | Left | 958623323 | 3:96591831-96591853 | CCACCATTAATTGCAATAAAAGT | No data | ||
| Right | 958623328 | 3:96591884-96591906 | CTATTGAAATATAGCCTAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958623323 | Original CRISPR | ACTTTTATTGCAATTAATGG TGG (reversed) | Intergenic | ||