ID: 958623323

View in Genome Browser
Species Human (GRCh38)
Location 3:96591831-96591853
Sequence ACTTTTATTGCAATTAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958623323_958623328 30 Left 958623323 3:96591831-96591853 CCACCATTAATTGCAATAAAAGT No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958623323 Original CRISPR ACTTTTATTGCAATTAATGG TGG (reversed) Intergenic