ID: 958623324

View in Genome Browser
Species Human (GRCh38)
Location 3:96591834-96591856
Sequence ACTACTTTTATTGCAATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958623324_958623328 27 Left 958623324 3:96591834-96591856 CCATTAATTGCAATAAAAGTAGT No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958623324 Original CRISPR ACTACTTTTATTGCAATTAA TGG (reversed) Intergenic
No off target data available for this crispr