ID: 958623325

View in Genome Browser
Species Human (GRCh38)
Location 3:96591859-96591881
Sequence TCTTCACTGTTTAGGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958623325_958623328 2 Left 958623325 3:96591859-96591881 CCCTCTATCCTAAACAGTGAAGA No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data
958623325_958623329 11 Left 958623325 3:96591859-96591881 CCCTCTATCCTAAACAGTGAAGA No data
Right 958623329 3:96591893-96591915 TATAGCCTAAGTGGTTGAATAGG No data
958623325_958623331 24 Left 958623325 3:96591859-96591881 CCCTCTATCCTAAACAGTGAAGA No data
Right 958623331 3:96591906-96591928 GTTGAATAGGAATATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958623325 Original CRISPR TCTTCACTGTTTAGGATAGA GGG (reversed) Intergenic
No off target data available for this crispr