ID: 958623327

View in Genome Browser
Species Human (GRCh38)
Location 3:96591867-96591889
Sequence CAATAGTCTCTTCACTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958623327_958623328 -6 Left 958623327 3:96591867-96591889 CCTAAACAGTGAAGAGACTATTG No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data
958623327_958623331 16 Left 958623327 3:96591867-96591889 CCTAAACAGTGAAGAGACTATTG No data
Right 958623331 3:96591906-96591928 GTTGAATAGGAATATTTTCTAGG No data
958623327_958623329 3 Left 958623327 3:96591867-96591889 CCTAAACAGTGAAGAGACTATTG No data
Right 958623329 3:96591893-96591915 TATAGCCTAAGTGGTTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958623327 Original CRISPR CAATAGTCTCTTCACTGTTT AGG (reversed) Intergenic
No off target data available for this crispr