ID: 958623328

View in Genome Browser
Species Human (GRCh38)
Location 3:96591884-96591906
Sequence CTATTGAAATATAGCCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958623327_958623328 -6 Left 958623327 3:96591867-96591889 CCTAAACAGTGAAGAGACTATTG No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data
958623326_958623328 1 Left 958623326 3:96591860-96591882 CCTCTATCCTAAACAGTGAAGAG No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data
958623323_958623328 30 Left 958623323 3:96591831-96591853 CCACCATTAATTGCAATAAAAGT No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data
958623324_958623328 27 Left 958623324 3:96591834-96591856 CCATTAATTGCAATAAAAGTAGT No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data
958623325_958623328 2 Left 958623325 3:96591859-96591881 CCCTCTATCCTAAACAGTGAAGA No data
Right 958623328 3:96591884-96591906 CTATTGAAATATAGCCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958623328 Original CRISPR CTATTGAAATATAGCCTAAG TGG Intergenic
No off target data available for this crispr