ID: 958626787

View in Genome Browser
Species Human (GRCh38)
Location 3:96636127-96636149
Sequence GAGCAGACCCAGATTTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958626784_958626787 8 Left 958626784 3:96636096-96636118 CCCATTGCTTGAAAGAAGATGGA No data
Right 958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG No data
958626785_958626787 7 Left 958626785 3:96636097-96636119 CCATTGCTTGAAAGAAGATGGAG No data
Right 958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958626787 Original CRISPR GAGCAGACCCAGATTTAAAA AGG Intergenic
No off target data available for this crispr