ID: 958632868

View in Genome Browser
Species Human (GRCh38)
Location 3:96703725-96703747
Sequence AACACAGAGGCGCCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958632865_958632868 -5 Left 958632865 3:96703707-96703729 CCGAGATCCTAGTGGGCAAACAC No data
Right 958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG No data
958632863_958632868 -3 Left 958632863 3:96703705-96703727 CCCCGAGATCCTAGTGGGCAAAC No data
Right 958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG No data
958632858_958632868 16 Left 958632858 3:96703686-96703708 CCTCCATGGACCTATAAAACCCC No data
Right 958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG No data
958632860_958632868 6 Left 958632860 3:96703696-96703718 CCTATAAAACCCCGAGATCCTAG No data
Right 958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG No data
958632864_958632868 -4 Left 958632864 3:96703706-96703728 CCCGAGATCCTAGTGGGCAAACA No data
Right 958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG No data
958632859_958632868 13 Left 958632859 3:96703689-96703711 CCATGGACCTATAAAACCCCGAG No data
Right 958632868 3:96703725-96703747 AACACAGAGGCGCCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958632868 Original CRISPR AACACAGAGGCGCCCAGACA TGG Intergenic
No off target data available for this crispr