ID: 958634123

View in Genome Browser
Species Human (GRCh38)
Location 3:96720973-96720995
Sequence GAATCTAAGCTCTTAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958634123_958634126 8 Left 958634123 3:96720973-96720995 CCTGGCTTTAAGAGCTTAGATTC No data
Right 958634126 3:96721004-96721026 CTTCAGAGATGGAGAAAGGTAGG No data
958634123_958634125 4 Left 958634123 3:96720973-96720995 CCTGGCTTTAAGAGCTTAGATTC No data
Right 958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG No data
958634123_958634124 -3 Left 958634123 3:96720973-96720995 CCTGGCTTTAAGAGCTTAGATTC No data
Right 958634124 3:96720993-96721015 TTCTATGAAATCTTCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958634123 Original CRISPR GAATCTAAGCTCTTAAAGCC AGG (reversed) Intergenic
No off target data available for this crispr