ID: 958653484

View in Genome Browser
Species Human (GRCh38)
Location 3:96970642-96970664
Sequence CCATAGGATGTTCCCACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958653484_958653488 -10 Left 958653484 3:96970642-96970664 CCTGTTGTGGGAACATCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 958653488 3:96970655-96970677 CATCCTATGGGAGGCTTGTGTGG 0: 1
1: 0
2: 2
3: 11
4: 134
958653484_958653489 -9 Left 958653484 3:96970642-96970664 CCTGTTGTGGGAACATCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 958653489 3:96970656-96970678 ATCCTATGGGAGGCTTGTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958653484 Original CRISPR CCATAGGATGTTCCCACAAC AGG (reversed) Intronic
902611847 1:17602430-17602452 ACTTACGAAGTTCCCACAACAGG + Intronic
903917754 1:26776613-26776635 CCATAGGATGTGCACACTAGTGG + Intronic
905932395 1:41798471-41798493 CCATAGGCTGATGCCACACCAGG + Intronic
913464195 1:119122800-119122822 ACATAGTATGTTCTCACAAGTGG + Intronic
914320021 1:146550044-146550066 CCAAAGGATGTGCCCTCAACTGG - Intergenic
922764120 1:228148827-228148849 CCCCAGGATGTTCCAACCACAGG - Exonic
1066951096 10:42117398-42117420 CCATAGGTTGTACCCACACTCGG - Intergenic
1068739853 10:60456641-60456663 CAATAGGATGGTCCCATAGCAGG + Intronic
1076680853 10:132170458-132170480 CCCGAGCAGGTTCCCACAACAGG + Intronic
1082088691 11:48071160-48071182 CCATAGAATGTTCCCTGCACTGG - Intronic
1082301166 11:50508468-50508490 CCATAAGCTGGTCCCAAAACTGG + Intergenic
1084084650 11:66849436-66849458 CCATAGGAAGTCCCCACACTGGG + Intronic
1086511224 11:87560048-87560070 CCAAAGGGCGTTGCCACAACTGG + Intergenic
1089664443 11:120009269-120009291 CCACAGGAGGGTCCCAGAACTGG + Intergenic
1096954564 12:55512669-55512691 CCCTAGGATGTACTCAAAACTGG + Intergenic
1101777748 12:107809030-107809052 GGATAAGGTGTTCCCACAACAGG - Intergenic
1114610822 14:24039089-24039111 CCACAGGATGTTTTCCCAACAGG - Intergenic
1115390403 14:32848005-32848027 ACAAACGATGTTCCCACAGCAGG - Intergenic
1118225601 14:63896217-63896239 CCATAGCATGTTCTCATAAAAGG + Intronic
1122053101 14:99073602-99073624 GCATGGGAGGTTCCCACAGCAGG + Intergenic
1130705885 15:86232580-86232602 CCATCGGCTGTTCCCACCCCTGG - Intronic
1136710648 16:32234148-32234170 GCACAGGATGTTCCCAGGACTGG - Intergenic
1136757263 16:32695263-32695285 GCACAGGATGTTCCCAGGACTGG + Intergenic
1136810845 16:33175112-33175134 GCACAGGATGTTCCCAGGACTGG - Intergenic
1136817321 16:33285192-33285214 GCACAGGATGTTCCCAGGACTGG - Intronic
1136823884 16:33341721-33341743 GCACAGGATGTTCCCAGGACTGG - Intergenic
1139185098 16:64796869-64796891 GCATAGGATGCTCCCACCCCAGG - Intergenic
1139937852 16:70584163-70584185 CCCTAGGATCGTCCCACACCTGG - Intronic
1140013505 16:71160033-71160055 CCAAAGGATGTGCCCTCAACTGG + Intronic
1203059413 16_KI270728v1_random:955614-955636 GCACAGGATGTTCCCAGGACTGG + Intergenic
1143109956 17:4547628-4547650 CCAGAAGGTGTTCCCACAGCAGG + Intronic
1144482673 17:15640435-15640457 GCATAGGATGTTACCCTAACTGG - Intronic
1144916015 17:18724597-18724619 GCATAGGATGTTACCCTAACTGG + Intronic
1149337500 17:55651308-55651330 CCATAGGCTGATGCCACACCAGG - Intergenic
1153023021 18:648259-648281 CCATTGGAAGTCCCAACAACTGG - Intronic
1154082970 18:11276297-11276319 CCATGGGATGTTCCCCAAACAGG - Intergenic
1160898717 19:1415935-1415957 ACAAAGCATGTTCCCACCACAGG - Intronic
1163720775 19:18897180-18897202 CCGCAGGATGTCCCCACACCTGG + Intergenic
1167247965 19:48385212-48385234 GCATATGCTGTTCCCACAGCAGG + Intronic
1167407781 19:49325003-49325025 CCCTAAAATGTTCCCACATCTGG - Intronic
935240647 2:101175205-101175227 CCATAAACTGGTCCCACAACTGG - Intronic
935977280 2:108591288-108591310 CTACAGGATGTTCACACATCTGG - Intronic
937623247 2:124014158-124014180 CCTTATGATGTTCCCACATGTGG - Intergenic
937891578 2:126943158-126943180 CCGAAGGATTGTCCCACAACAGG - Intergenic
940123826 2:150299920-150299942 CCATAAGATGTGCCCACCAGGGG + Intergenic
1168910010 20:1440143-1440165 CCACAGGGTGTTCCTGCAACAGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171257959 20:23705435-23705457 GCATAGGGTGTTCTCACAGCTGG - Intergenic
1171981398 20:31631838-31631860 ACATAGGCTGTCCCCACATCTGG + Intergenic
1176142995 20:63553447-63553469 CCACAGGGTCTTCCCACCACAGG - Intronic
1179789606 21:43748830-43748852 CGATAAGTTGTTCCCACCACGGG - Intronic
1185003965 22:48264403-48264425 CCTTAGAATGTTCCAACACCAGG + Intergenic
1185111900 22:48904976-48904998 CCATGGGAGGTGCCCACATCAGG - Intergenic
1185111917 22:48905041-48905063 CCATGGGAGGTGCCCACATCAGG - Intergenic
1185111965 22:48905236-48905258 CCATGGGAGGTGCCCACATCAGG - Intergenic
949633040 3:5950131-5950153 CCATAAGATGTATCCACAAGGGG - Intergenic
952560008 3:34580836-34580858 CCATATGATGTTCCCATGAAGGG - Intergenic
953556267 3:43949091-43949113 CCATAGGTTGTTGGCAGAACCGG - Intergenic
958653484 3:96970642-96970664 CCATAGGATGTTCCCACAACAGG - Intronic
958672577 3:97223450-97223472 CCCAAGCTTGTTCCCACAACAGG - Intronic
964514162 3:157489154-157489176 CCACAGACTGTTCCCAAAACAGG + Intronic
965423328 3:168490005-168490027 CCAAAGGATGTCCCCTCTACTGG - Intergenic
966043776 3:175525420-175525442 CCATTAGATGTGTCCACAACAGG - Intronic
967572042 3:191041121-191041143 CCACAGATTGTTCCCCCAACAGG - Intergenic
970695650 4:18673788-18673810 CCAGAGGATGTTGCAACAATTGG - Intergenic
970829650 4:20321900-20321922 CCAGATGATGTTCACACTACCGG - Intronic
976596114 4:86896761-86896783 CAGTAGGAAGTTCCCACAAACGG - Intronic
979149076 4:117285412-117285434 CCATAAACTGTTCCCAAAACTGG + Intergenic
982333796 4:154211596-154211618 CGATAGAATTTTCCCACATCTGG - Intergenic
990093574 5:52084349-52084371 CCATAGGTCCCTCCCACAACAGG + Intergenic
990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG + Intergenic
996031867 5:118714424-118714446 CCATAGATTGTTCACACCACAGG + Intergenic
1000849455 5:166322150-166322172 CCCTAGGAGCTTCCCAGAACTGG + Intergenic
1005185489 6:23159588-23159610 CCATAAACTGTTCCCAAAACTGG + Intergenic
1005901241 6:30218499-30218521 CCATAGAATGTTCCCAGTACTGG + Intergenic
1006038033 6:31229346-31229368 CCACAGGGTGCTCCCACAAAAGG + Intergenic
1010465674 6:76165396-76165418 CCAGGGGAAGTTCCCACCACTGG + Intergenic
1017865833 6:158442448-158442470 GGATAGGATGTTCCCCCAACAGG + Intronic
1022609866 7:31859647-31859669 CCATAAGATGATCCCACTACTGG + Intronic
1028626310 7:92881104-92881126 CCAGAGAATTTTCCCACCACTGG + Intergenic
1031676226 7:124615744-124615766 CGAGAGGATGTTGCCACTACTGG - Intergenic
1038227121 8:25667765-25667787 CCACAGGAGGTTCTCACAACAGG + Intergenic
1038841712 8:31190414-31190436 CCATAAAATGTTCTCACTACAGG - Intergenic
1039914064 8:41846732-41846754 CCACAGGCTGTTCTCACAGCTGG + Intronic
1040067564 8:43160248-43160270 CCACAGAATTTTCCCTCAACAGG - Intronic
1047798984 8:128289157-128289179 CCAAAGGATGTACACAGAACAGG - Intergenic
1048867450 8:138771240-138771262 CCAAAGGAAGCTCCCACAGCAGG + Intronic
1057913805 9:99040409-99040431 CCTCAGCATGTTCCCACAGCTGG - Intronic
1058126386 9:101200082-101200104 CCCTAGCATGTTCCTACAGCTGG - Intronic
1192888602 X:75363783-75363805 ACAGAGGATTTTCCCAAAACGGG - Intergenic
1193313943 X:80042659-80042681 CCATAAGCTGGTCCCAAAACTGG + Intergenic
1194355090 X:92873270-92873292 CCTTAGGAAGTTCTCACAAAAGG + Intergenic
1195219911 X:102736958-102736980 CCAGAGGTTTTTCCCAAAACGGG + Intronic
1200663450 Y:5990289-5990311 CCTTAGGAAGTTCTCACAAAAGG + Intergenic
1201400306 Y:13597593-13597615 GTATAGGATGTTGCCACCACTGG + Intergenic