ID: 958655148

View in Genome Browser
Species Human (GRCh38)
Location 3:96991824-96991846
Sequence CACACAACACACATGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958655141_958655148 29 Left 958655141 3:96991772-96991794 CCCTGTTGATCTGCAGAACTAAG 0: 1
1: 0
2: 1
3: 9
4: 120
Right 958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG 0: 1
1: 0
2: 4
3: 24
4: 257
958655142_958655148 28 Left 958655142 3:96991773-96991795 CCTGTTGATCTGCAGAACTAAGA 0: 1
1: 0
2: 0
3: 16
4: 114
Right 958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG 0: 1
1: 0
2: 4
3: 24
4: 257
958655144_958655148 4 Left 958655144 3:96991797-96991819 CCTAAAAATAAGTTATGGTTCCT 0: 1
1: 0
2: 1
3: 17
4: 204
Right 958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG 0: 1
1: 0
2: 4
3: 24
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958655148 Original CRISPR CACACAACACACATGGAACA GGG Intronic
900690389 1:3977280-3977302 CACACAGCACACAACGCACAAGG - Intergenic
901779131 1:11581280-11581302 CACAAGACAGACCTGGAACAGGG - Intergenic
903337722 1:22636080-22636102 CATACAAAACACTTGGCACATGG - Intergenic
907112007 1:51935087-51935109 CACAGAACACACAGCGAAGAAGG + Intronic
907547841 1:55277548-55277570 CACACACAACACGTGGAGCACGG - Intergenic
908495444 1:64689705-64689727 CATCCAAGCCACATGGAACAGGG + Intronic
910002448 1:82356303-82356325 CACACAAGACAAATGGACCAAGG - Intergenic
912222135 1:107690278-107690300 CAGAGAACCCTCATGGAACATGG - Intronic
913502830 1:119487891-119487913 GACAAATCACACATGGAAAAAGG + Intergenic
914195183 1:145444634-145444656 CTGACAAGACACATGTAACAGGG + Intergenic
914476454 1:148027210-148027232 CTGACAAGACACATGTAACAGGG + Intergenic
915582329 1:156821919-156821941 CAAACATCACACATGGGCCATGG - Intronic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918659156 1:187068138-187068160 CACACAACACACATACACAATGG + Intergenic
918823506 1:189291164-189291186 TACACCATTCACATGGAACATGG - Intergenic
920620371 1:207540500-207540522 CAAACAACTCACAGGGAAGATGG - Intronic
920622153 1:207559057-207559079 CAAACAACTCACAGGGAAGATGG - Intronic
920623762 1:207576108-207576130 CAAACAACTCACAGGGAAGATGG - Intronic
920636399 1:207708690-207708712 CAAACAACTCACAGGGAAGATGG - Intronic
923002022 1:230014459-230014481 CAAAAAACACACACAGAACAAGG - Intergenic
923020784 1:230161916-230161938 AACACAAAAGAAATGGAACATGG - Intronic
923280259 1:232436723-232436745 CACTCAACACACAGAAAACAAGG + Intronic
1063091764 10:2871753-2871775 CACACCACAAACATGTCACATGG + Intergenic
1063091769 10:2871837-2871859 CACACCACAAACATGTCACATGG + Intergenic
1063091772 10:2871894-2871916 CACACCACAAACATGTCACATGG + Intergenic
1063091775 10:2871951-2871973 CACACCACAAACATGTCACATGG + Intergenic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1063699557 10:8371300-8371322 GACACAACACAGAGGGAAGAAGG - Intergenic
1064566392 10:16643696-16643718 TACATAACAGACTTGGAACATGG + Intronic
1064651073 10:17510377-17510399 CTCACAACCCACAAGGAACTTGG + Intergenic
1065068334 10:21997042-21997064 TACACAACACACATGTACAAAGG + Intronic
1065354154 10:24822792-24822814 CACACAACAGAAATGGATCACGG + Intergenic
1066046479 10:31599868-31599890 CAGAGAACACACATGGTAAAGGG + Intergenic
1069456435 10:68557784-68557806 CACACAATACACAGGGCTCAGGG - Intergenic
1070958856 10:80484842-80484864 CACACCACACCCAGAGAACAGGG - Intronic
1071456153 10:85853061-85853083 CCCACATCACACATGGACCCAGG + Intronic
1071693790 10:87850969-87850991 CACCAAACCCACATGGAGCAAGG - Intergenic
1072666056 10:97393286-97393308 CACTGAGCACACATGGAACCAGG + Intronic
1072838525 10:98743541-98743563 CACAGAACACACATTGTAAAAGG + Intronic
1074207649 10:111297881-111297903 CACACAGCAGTCATGGATCATGG - Intergenic
1075740006 10:124689542-124689564 CACACAAGGCACAAGGAACAAGG + Intronic
1076006738 10:126953728-126953750 ACCCCAACACACGTGGAACAAGG - Intronic
1076728192 10:132423309-132423331 CACACAAACCACATGTCACATGG - Intergenic
1078820744 11:14878678-14878700 TACACAAGACCCATGGAAGATGG - Intronic
1079471999 11:20787181-20787203 GACTACACACACATGGAACAGGG - Intronic
1080357851 11:31472512-31472534 TTCACAGCACACATGGTACATGG - Intronic
1081286917 11:41281999-41282021 CACACATCACACATCCACCAAGG - Intronic
1081689033 11:45063807-45063829 CAGAAAACACACATATAACAAGG + Intergenic
1084426176 11:69085642-69085664 AACACAACACACCTGGGTCAGGG - Intronic
1086941808 11:92806036-92806058 CACACACCACACATTGACCATGG - Intronic
1088344669 11:108809359-108809381 CAACCAACACACATGGAGGAAGG - Intronic
1088345429 11:108819160-108819182 AACAAAACAGACATGGAAAAGGG - Intronic
1090609384 11:128456620-128456642 CACACATCAAATATGGGACAAGG - Intergenic
1090932094 11:131307065-131307087 CACAGAAGACACATGGAATCAGG + Intergenic
1091613486 12:2031485-2031507 CAAACAAAAGACATGGGACAAGG - Intronic
1093274667 12:17109449-17109471 CACTCAATGCAAATGGAACACGG + Intergenic
1093477902 12:19574854-19574876 CACAATCCACACATGGCACATGG - Intronic
1094251458 12:28366904-28366926 CACTCAGCATACAGGGAACAAGG - Intronic
1095982280 12:47980398-47980420 CACACAGCCCACATGCCACATGG + Intronic
1096711784 12:53462860-53462882 CACCCCACACACATAAAACATGG - Intronic
1106204149 13:27573646-27573668 CACAGAACCCCCATGGAAGACGG + Intronic
1108417676 13:50215984-50216006 CTCAAAATGCACATGGAACATGG + Intronic
1109495285 13:63162355-63162377 GACACAACACACATTGAACTAGG - Intergenic
1112471867 13:99696574-99696596 TACATAAGACACATGGCACATGG + Intronic
1114189168 14:20428157-20428179 CACACAACACTCCTGCCACATGG + Intergenic
1115626635 14:35199708-35199730 CACACAAAACACCTGAAACTAGG - Intronic
1115920722 14:38370268-38370290 ATCACAACACACATAAAACAAGG + Intergenic
1116387881 14:44354903-44354925 AACACAACATCCATGGACCAAGG - Intergenic
1119048611 14:71343848-71343870 AACACAACACACTTGTAACTTGG - Intronic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1120695437 14:87639310-87639332 CACACCACACACATAGAAAAGGG + Intergenic
1123157151 14:106238450-106238472 CACACACCACACATCCACCATGG + Intergenic
1123396960 15:19946016-19946038 CACACACCGCACATCCAACATGG + Intergenic
1123500235 15:20875366-20875388 CTCACCACACACATGAAAGAGGG - Intergenic
1123557481 15:21449060-21449082 CTCACCACACACATGAAAGAGGG - Intergenic
1123593708 15:21886322-21886344 CTCACCACACACATGAAAGAGGG - Intergenic
1123802230 15:23833370-23833392 CAAACAAAACACATTGAAAATGG + Intergenic
1123931082 15:25171942-25171964 CAGAGAACACACATGGCCCAGGG + Intergenic
1127601531 15:60542655-60542677 CACCTCACACACATGGCACACGG + Intronic
1128550924 15:68597486-68597508 CACACAACGGAAATGGAACCAGG + Intronic
1128953845 15:71918512-71918534 AAAACAACACACATGTAAAAAGG + Intronic
1129425003 15:75456127-75456149 CACACAACCCATTTGGAACTAGG + Intergenic
1129895453 15:79102319-79102341 CACACAACTCACATGTGGCAGGG + Intergenic
1130910029 15:88264599-88264621 CACACAACACACATTTAAGTAGG + Intergenic
1131783646 15:95887481-95887503 CACACATCTCGCATGTAACAAGG + Intergenic
1131828586 15:96340160-96340182 CACAAAACAAACAAGGAAAAGGG - Exonic
1202965830 15_KI270727v1_random:176233-176255 CTCACCACACACATGAAAGAGGG - Intergenic
1134420898 16:14088241-14088263 CACACAAAAGACATTGCACAAGG - Intronic
1135173842 16:20210548-20210570 CCGACAACACAAATGGAACTTGG - Intergenic
1135435312 16:22422950-22422972 CACACAGCACACAGGGGTCACGG + Intronic
1135685327 16:24494205-24494227 CACACAACACTGATGTATCAAGG - Intergenic
1140240716 16:73197406-73197428 CAGACAACAGACATGGTACTTGG - Intergenic
1141304812 16:82852260-82852282 CACTAAACATCCATGGAACAAGG - Intronic
1142724184 17:1799848-1799870 CATACAACACACAGGTAAGAGGG - Exonic
1143840363 17:9726830-9726852 CACACAACCTACATGGCGCAAGG - Intronic
1144317176 17:14072781-14072803 CACACAGCACACCTGGACTATGG - Intronic
1146056172 17:29582334-29582356 CACACAGCACACGTGGTAGATGG - Intronic
1146402224 17:32508852-32508874 CACACAGCAAACAGGGACCACGG - Intronic
1146875919 17:36410631-36410653 CACACCACACACATGAAAAATGG - Intronic
1147063467 17:37902237-37902259 CACACCACACACATGAAAAATGG + Intergenic
1149169295 17:53791310-53791332 CAAACAAAAAACAGGGAACAGGG + Intergenic
1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG + Intergenic
1151497862 17:74469960-74469982 CACACAACACAGAAAGAACCAGG - Intronic
1151712685 17:75815583-75815605 CAGACATCACTAATGGAACATGG + Intronic
1155062584 18:22241852-22241874 CACAAATCACGGATGGAACAAGG + Intergenic
1155550971 18:26964707-26964729 ATCACAGCACACATGGAAGAAGG - Intronic
1156713794 18:39981824-39981846 CATAAACCACAAATGGAACAGGG - Intergenic
1157282636 18:46356224-46356246 CCTAGAACACACCTGGAACAGGG - Intronic
1157401718 18:47394213-47394235 CACTCCACACACCTGGGACAGGG - Intergenic
1158619280 18:59017430-59017452 CACAGCACACATATGGAACAAGG - Intergenic
1160524577 18:79527362-79527384 CTCACGACACTCATGGACCAGGG + Intronic
1160716096 19:577495-577517 AACACAAAACACATGAAACTGGG - Intronic
1160784868 19:895457-895479 GACATAACACACAGGGAAAACGG + Intergenic
1161188390 19:2938584-2938606 ATCCCAACACCCATGGAACATGG - Intronic
1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG + Intergenic
1163695706 19:18762269-18762291 CACACAACATACGTGGAAGCTGG + Intronic
1163894026 19:20041422-20041444 CACTGAGCACACATGGAACCAGG - Intergenic
1164633235 19:29775187-29775209 AACAAGACACAAATGGAACAAGG + Intergenic
1165159241 19:33806141-33806163 CACAGCACACACATGCAACAGGG - Intronic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
1168187463 19:54709223-54709245 CACACGGCCCACAGGGAACAGGG - Intergenic
928165999 2:28972619-28972641 CACAAAACACACTTGGAGAATGG + Intronic
928907915 2:36387489-36387511 CACAGCACAAACATGGAACAGGG + Intronic
929022849 2:37570918-37570940 CACACAACACTCACTAAACATGG + Intergenic
931701181 2:64910369-64910391 CACACCCCACCCATGGAACCAGG + Intergenic
934899612 2:98148067-98148089 CACACAACACATATACACCATGG - Intronic
936561798 2:113545303-113545325 CCCACAATAAACATTGAACAGGG - Intergenic
936806765 2:116342697-116342719 CATCCAATCCACATGGAACAAGG - Intergenic
937081770 2:119145323-119145345 CAAACACCACACATGGCACATGG + Intergenic
937783905 2:125873105-125873127 CACACAACACAGATGAATGAGGG + Intergenic
938839440 2:135144726-135144748 CACAAAACACAAATGGCAAATGG - Intronic
939048062 2:137273000-137273022 CACACCACACACACGGGAGAAGG + Intronic
941542380 2:166802888-166802910 CACATAACCCACATGAAACAGGG + Intergenic
942329282 2:174805108-174805130 TACAAAATACACATGGAATAAGG + Intronic
942642527 2:178074819-178074841 CACACACCAAGCAGGGAACATGG - Intronic
942864781 2:180660238-180660260 CTCACAGAGCACATGGAACATGG + Intergenic
944004577 2:194888771-194888793 TCCACAACACACATGAAGCATGG + Intergenic
946884133 2:224206186-224206208 CACAAACCACTCATGGGACAGGG + Intergenic
946907057 2:224427736-224427758 CACAGATCACACATGACACATGG - Intergenic
947722493 2:232378448-232378470 CACACAAGACACAGTGAGCAGGG + Intergenic
947726832 2:232406562-232406584 CACACAAGACACAGTGAGCAGGG + Intergenic
947955644 2:234188218-234188240 CACACAACACACAAGCCACCTGG - Intergenic
948698611 2:239746954-239746976 CACCCCATACACGTGGAACAGGG + Intergenic
1168869569 20:1116953-1116975 CAAACAGAACACATGAAACAGGG + Intronic
1170997850 20:21381836-21381858 CACACACCACAAATGTAAAAAGG - Intronic
1172836214 20:37874925-37874947 CACACAAAACTAATGGAAAAGGG - Intergenic
1173093234 20:39996485-39996507 CACAAAATACACATAGGACATGG + Intergenic
1175176000 20:57112482-57112504 CTCATACCACACCTGGAACATGG - Intergenic
1175189450 20:57201342-57201364 GACACAAAACACATGGAACAAGG + Intronic
1176743469 21:10628881-10628903 CACACACCACACATCCAACATGG + Intergenic
1176973887 21:15296414-15296436 CACATAACAAGCATGGAACAAGG - Intergenic
1177444883 21:21181473-21181495 CACACGACAAGCATGCAACAAGG - Intronic
1179532249 21:42027898-42027920 AAGACAACGCACATGGGACATGG + Intergenic
1179590418 21:42404322-42404344 CAGCCAACACAAATTGAACAGGG - Intronic
1180983571 22:19891068-19891090 AACACAACATGCATGGAGCATGG - Intronic
1181018311 22:20084219-20084241 CAGACATCACACATTTAACAAGG - Intronic
1183531102 22:38353796-38353818 AACACAACCCACCTGGAACCCGG - Intronic
1183615881 22:38945106-38945128 CACACAACCCAGAGGGGACAGGG - Intergenic
1185002290 22:48253391-48253413 CACGAAATACACGTGGAACACGG - Intergenic
949920472 3:8996337-8996359 CCCACCACACACATGCACCAGGG + Intronic
950451011 3:13065739-13065761 CACCCAACAGAAATGGAACCAGG + Intronic
952051041 3:29385025-29385047 CACACAACAGGCAGGAAACAGGG - Intronic
952752589 3:36837309-36837331 CCCATAATAAACATGGAACAGGG + Intronic
953762569 3:45701633-45701655 TAAACTACACACATGGAAAAGGG + Intronic
956546729 3:70411584-70411606 CCCACAACACATAGGGATCATGG - Intergenic
958583795 3:96060615-96060637 CACACAAGACACATTTTACATGG - Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
959624895 3:108438646-108438668 CTCACATCACACAAGGAACAAGG - Intronic
962310645 3:134324540-134324562 AACACACCACACAGGGAACGGGG + Intergenic
962741525 3:138365809-138365831 CAGACAACACTGATGGATCATGG - Intronic
963077117 3:141357245-141357267 CAAACAACACACAAGAAAGAGGG - Intronic
965632783 3:170750370-170750392 CACACAATACAAATAGAATATGG - Intronic
965842764 3:172926404-172926426 CACACAAAACTCTTAGAACAGGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966169183 3:177058597-177058619 AAAACAACACACATTGTACATGG - Intronic
966326098 3:178756432-178756454 CATAAAACACACATAAAACAAGG - Intronic
967955689 3:194875784-194875806 CACACTGCACACATGTAGCAGGG + Intergenic
969600413 4:8172744-8172766 CACACAAACCAGATGGCACAAGG + Intergenic
970849921 4:20589633-20589655 CACACAACTCACCTGCAACAGGG - Exonic
972658647 4:41092106-41092128 CAAACAACAGACATGCATCAAGG + Intronic
975975814 4:80095264-80095286 CACACTATATACATGGAAGAGGG - Intronic
976641293 4:87341492-87341514 TACACAACAAAGATGTAACATGG - Intronic
978380480 4:108123014-108123036 ATCACAACACACAGGAAACATGG - Intronic
980866579 4:138560524-138560546 CTCACATCTCACAAGGAACATGG + Intergenic
982883710 4:160751145-160751167 CAGCCAACACACATGAAAAAAGG + Intergenic
983281672 4:165688970-165688992 CACACAACACACTAAGGACAAGG - Intergenic
984975856 4:185229433-185229455 AAGACAACAGACATAGAACATGG - Intronic
985551667 5:536355-536377 CACACAACACTCAGGGAGAAAGG - Intergenic
985628413 5:1002157-1002179 CAAACCACACATTTGGAACATGG + Intergenic
985818271 5:2142779-2142801 CAGAAAACACACAGGGAAGAAGG - Intergenic
986685422 5:10271868-10271890 CACGCAAGGGACATGGAACATGG + Intergenic
987044142 5:14090760-14090782 CACCCAACAAATATGGAATAGGG - Intergenic
987122800 5:14783325-14783347 CACACACCACACATGGAGATAGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
988171755 5:27666563-27666585 CACACAAATCATATAGAACAGGG + Intergenic
990963158 5:61416029-61416051 CACCCAACACAAATGTAAGAAGG - Intronic
991094437 5:62724411-62724433 GTGACAACACACATGGAAGAGGG + Intergenic
991295212 5:65073239-65073261 CACACAGCACATATGATACAAGG + Intergenic
991557881 5:67915808-67915830 CACATAAAACAGATGGAAAATGG - Intergenic
993629351 5:90265963-90265985 CACACCACACACATGTGACATGG - Intergenic
994468374 5:100169482-100169504 GATACAAAACACATGAAACAAGG + Intergenic
995360373 5:111290023-111290045 CAAATTACACACATGGAAGATGG + Intronic
996339887 5:122424971-122424993 CATTCAACAAACATAGAACAGGG + Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998461004 5:142310037-142310059 CACACAACATACATGCTTCAAGG - Intergenic
998465320 5:142339246-142339268 CACAAAACACACAGGAAATAAGG - Intergenic
998682149 5:144480580-144480602 CACATAACCCACATGAATCAAGG - Exonic
999809698 5:155115741-155115763 CACAGAACAGACAGGGACCAAGG - Intergenic
1000011199 5:157234736-157234758 CACATCACACACCAGGAACATGG + Intronic
1000339070 5:160263129-160263151 GACAGAGCACACATGGATCAGGG - Intronic
1001120554 5:168976636-168976658 CACACAGCACAGGAGGAACAAGG - Intronic
1001149057 5:169210897-169210919 CACCCAACATCAATGGAACATGG - Intronic
1001492672 5:172166451-172166473 CACACAACACGCGTGTATCAAGG + Intronic
1001589523 5:172855814-172855836 CTCACAGCCCACATGGAACCTGG - Intronic
1001721641 5:173861654-173861676 CACAGAGCACACATGCTACACGG + Intergenic
1002554563 5:180025404-180025426 CAAACAACCCACTTGGGACACGG + Intronic
1003833764 6:10044249-10044271 CAGAAAACACACAGGGAAGAAGG - Intronic
1004311994 6:14554070-14554092 CAGGCATCACACTTGGAACAGGG - Intergenic
1004532267 6:16464364-16464386 GACAGAACAGAAATGGAACATGG + Intronic
1007313080 6:40962133-40962155 CACAAAAAACACTTAGAACAGGG + Intergenic
1008677495 6:53835794-53835816 CACAGAACACACATGAAAACTGG - Intronic
1010379409 6:75207852-75207874 CACCCAACACACAAAGAGCAGGG + Intergenic
1010640116 6:78315141-78315163 GACACAAAACCCAGGGAACATGG + Intergenic
1012215604 6:96579594-96579616 CAAAATACACACATGGTACATGG - Intronic
1013288701 6:108701445-108701467 CAAACACCAGCCATGGAACATGG - Intergenic
1013305065 6:108840112-108840134 CACACAACACGTATCAAACAAGG - Intergenic
1013357249 6:109356904-109356926 AACAGAACACAGATGGAACTTGG + Intergenic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1017450831 6:154553025-154553047 CCCACAACATGCATGGAAAATGG + Intergenic
1018164428 6:161079785-161079807 CACACCACACACCTGGAGGATGG + Intronic
1019207534 6:170375259-170375281 CACACAGCACATAGGCAACAGGG + Intronic
1019359124 7:595664-595686 CACACAACACACACAGTACAGGG + Intronic
1019540823 7:1550256-1550278 CACCCCACACACCTGGGACAGGG - Intronic
1020280499 7:6647762-6647784 CACACACCACCCATGGCACCAGG - Intronic
1021650329 7:22826803-22826825 CACATAGCACACATGGCACATGG + Intergenic
1021650330 7:22826810-22826832 CACACATGGCACATGGCACATGG + Intergenic
1022136837 7:27457200-27457222 CACACAACACACAGGCAACAGGG + Intergenic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025964950 7:66260904-66260926 CCCAGAACTCACATAGAACAAGG - Intronic
1026926303 7:74196249-74196271 CACACAACACACAGGCAACAGGG - Exonic
1030910712 7:115245674-115245696 CACACAAGACAGAAGAAACACGG + Intergenic
1031001128 7:116415854-116415876 CACACAGCACACATCACACAAGG + Intronic
1031855892 7:126922351-126922373 CACAGTACACACATTGCACATGG - Intronic
1033550982 7:142447589-142447611 CACACATCACACGAGTAACAGGG + Intergenic
1035153073 7:156892133-156892155 CCAACAGCACACATGGAACATGG + Intronic
1035478947 7:159166099-159166121 CACACCACAGACATGCCACATGG - Intergenic
1037185999 8:16064512-16064534 CACACAACAAGCAAGGAGCAAGG + Intergenic
1037959855 8:23088477-23088499 CACGCACCACACATGGAACCAGG + Intronic
1040488443 8:47896715-47896737 CACTCTCCACACATGGCACAGGG + Intronic
1042346363 8:67732160-67732182 TACCCAAAACACATTGAACAGGG + Intronic
1043636146 8:82385274-82385296 CATCCACCACACATAGAACATGG - Intergenic
1044317413 8:90765877-90765899 CAAACTACAAGCATGGAACATGG - Intronic
1044442782 8:92241178-92241200 CAAGCAACACCCATTGAACACGG + Intergenic
1047700406 8:127443760-127443782 CCCATAACAGACATGGAATACGG + Intergenic
1049504367 8:142987783-142987805 CACACCCCACACATGGAATGTGG + Intergenic
1049567002 8:143345512-143345534 CTCACACCCCACGTGGAACAGGG + Intronic
1049736013 8:144205746-144205768 GACACAACACACATGTAACAGGG - Intronic
1049815760 8:144598630-144598652 CACACCACACACAAGAACCAAGG + Intronic
1049890883 9:70027-70049 CCCACAATAAACATTGAACAGGG + Intergenic
1050907633 9:11025930-11025952 CACACAAAACACATAGAATGTGG - Intergenic
1052750890 9:32489225-32489247 CTCAAAAGACACATGGAACAAGG + Intronic
1053732346 9:41071211-41071233 CCCACAATAAACATTGAACAGGG + Intergenic
1054696105 9:68360505-68360527 CCCACAATAAACATTGAACAGGG - Intronic
1055043286 9:71898655-71898677 CAAACAACACACATGGGAAAGGG + Intronic
1056655367 9:88504289-88504311 CACACCACACACCAGGAGCAGGG - Intergenic
1056716209 9:89032089-89032111 CACACAACACACACGTGACTTGG + Intronic
1057441055 9:95083755-95083777 CACACAGCACACGTGGCATATGG + Intronic
1057824002 9:98358510-98358532 CTCACAACCCTCATGGTACAGGG - Intronic
1059979820 9:119759322-119759344 GACACAACACAAATGAAAGAAGG + Intergenic
1060423125 9:123483591-123483613 CAGTCACCACACATGGAACCCGG - Intronic
1061051884 9:128201618-128201640 CACACAACTTGCATGGAACCTGG - Intronic
1061767692 9:132892186-132892208 CAAACAAGCCACATGGGACAAGG + Exonic
1185851120 X:3489597-3489619 CACACAAAACAGATAGGACAGGG + Intergenic
1185921213 X:4095346-4095368 CACACAAAACACATGAAAAGAGG - Intergenic
1186178453 X:6949730-6949752 AACACAACACACATGTATTATGG + Intergenic
1188860981 X:35255679-35255701 TACAAACCACACATTGAACAAGG + Intergenic
1189248258 X:39580153-39580175 CACAGAACACACAGGGATTATGG + Intergenic
1190376160 X:49790448-49790470 AACACAACACACCTTAAACATGG - Intergenic
1190376349 X:49792118-49792140 AATACAACACACTTTGAACATGG - Intergenic
1194120787 X:89961177-89961199 CAAACAACACACATACAAGATGG + Intergenic
1195749327 X:108148541-108148563 CACACACCACCCATGGGAAAAGG + Intronic
1196513137 X:116537727-116537749 CATAAAACACACATGAAAGATGG - Intergenic
1199678019 X:150204302-150204324 CACTCAACTGGCATGGAACAAGG + Intergenic
1200287388 X:154836550-154836572 AACACAACAAAAATGTAACAGGG - Exonic
1200412562 Y:2876016-2876038 CAAACAACACACACAAAACAAGG - Intronic