ID: 958660845

View in Genome Browser
Species Human (GRCh38)
Location 3:97064732-97064754
Sequence AAGCACTGACCAGTATCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958660845_958660848 10 Left 958660845 3:97064732-97064754 CCAAGTGATACTGGTCAGTGCTT 0: 1
1: 0
2: 2
3: 8
4: 98
Right 958660848 3:97064765-97064787 TATGTGTTAATTACATATGAGGG 0: 1
1: 0
2: 1
3: 39
4: 341
958660845_958660847 9 Left 958660845 3:97064732-97064754 CCAAGTGATACTGGTCAGTGCTT 0: 1
1: 0
2: 2
3: 8
4: 98
Right 958660847 3:97064764-97064786 ATATGTGTTAATTACATATGAGG 0: 1
1: 0
2: 2
3: 39
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958660845 Original CRISPR AAGCACTGACCAGTATCACT TGG (reversed) Intronic
902672342 1:17983513-17983535 TAGCACTGCCCACTATTACTGGG - Intergenic
904473232 1:30748566-30748588 AAGCTCTGACCAGAAGCACAGGG - Intronic
906190524 1:43896254-43896276 AAGGACTGAGAAGTATCCCTTGG - Intronic
909037192 1:70607082-70607104 AACCACAGACTAGTCTCACTTGG - Intergenic
910890717 1:92017056-92017078 AAGGACTGAGAAGTATCATTTGG - Intergenic
912991753 1:114494311-114494333 CACCATTGTCCAGTATCACTTGG + Intronic
914923432 1:151863065-151863087 AAACACTGAACTGTAGCACTTGG - Intergenic
916915242 1:169399879-169399901 AAGCAGTCACTAGTCTCACTGGG + Intronic
917479558 1:175400097-175400119 CAGCACTAACCACCATCACTGGG + Intronic
920586295 1:207165612-207165634 AAACAGTGACCAGCATCATTTGG - Intergenic
921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG + Exonic
924002751 1:239571881-239571903 AAGCACTGACCAGTATCAAGAGG - Intronic
1068866077 10:61897141-61897163 AAGCAATGACCCGTATAACCCGG + Intergenic
1068897764 10:62226462-62226484 AAACATTGACCAGAAACACTGGG - Intronic
1069899608 10:71699888-71699910 ATGCCCTGACCAGGATCACTTGG + Intronic
1071458337 10:85868433-85868455 AAGGACTGACCAGAAACACTTGG + Intronic
1072573180 10:96676335-96676357 CAGCAATGACCACTATCAGTTGG - Intronic
1074350581 10:112733029-112733051 ATGCACTGAGCAGAATCACCTGG - Intronic
1075436685 10:122449728-122449750 AAGCACTGACCAGGAGGACTGGG + Intergenic
1077454524 11:2670544-2670566 AGGGACTTGCCAGTATCACTGGG + Intronic
1080909660 11:36582841-36582863 AAGCACTGACTAAAAGCACTTGG - Intronic
1087624770 11:100583982-100584004 AAGCAGTGTCCAGCATCCCTAGG - Intergenic
1091271049 11:134312195-134312217 AAGCACAGAGCAGTGTCACATGG + Intronic
1095045579 12:37500472-37500494 AAGTAAGCACCAGTATCACTGGG - Intergenic
1099150755 12:79109780-79109802 AAACACTGACTAGCAACACTGGG - Intronic
1099770213 12:87042840-87042862 TAGCATTGACCAGTGTCACTTGG + Intergenic
1101671989 12:106884139-106884161 AAGCACTGACCAGGCTGCCTGGG - Intronic
1104804208 12:131574592-131574614 AAGCTCTGGCCAGGAACACTGGG - Intergenic
1110477338 13:75931679-75931701 AAGTACTGATCAGTGTCCCTGGG + Intergenic
1116216010 14:42017959-42017981 GATTACTGTCCAGTATCACTTGG - Intergenic
1116562007 14:46391639-46391661 AAGCACTGGGCAGTATGATTTGG - Intergenic
1119187821 14:72656041-72656063 AGGCACTGACCAGTTACATTTGG - Intronic
1121492939 14:94372723-94372745 AAGTCCAGAACAGTATCACTGGG - Intergenic
1123796957 15:23782029-23782051 AAGAACGGACCAGTATCAAGAGG - Intergenic
1124794779 15:32766994-32767016 AAGCACAGACCAGTTTCACTGGG + Exonic
1126037176 15:44557452-44557474 AAGCACTGAAAAGTATCAGGAGG - Intronic
1126105285 15:45143185-45143207 AGGCACTGAGCAGGCTCACTGGG - Exonic
1126289540 15:47058018-47058040 AAGTAAGCACCAGTATCACTGGG + Intergenic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1131748557 15:95478657-95478679 CAGAACTCAGCAGTATCACTGGG + Intergenic
1134095051 16:11413515-11413537 ATGCCCTGACCACTGTCACTTGG - Intronic
1136997006 16:35197628-35197650 AAGCACTGAGCAGGAGCACTGGG + Intergenic
1137327315 16:47454516-47454538 AAGCAGTAAGCATTATCACTGGG + Intronic
1137702926 16:50510188-50510210 GAGCACGCACCAGTATCCCTTGG + Intergenic
1144224794 17:13134565-13134587 CAGGACTGACCAGTAACACTTGG - Intergenic
1157825752 18:50810649-50810671 AAGCTGTGATCAGAATCACTTGG - Intronic
1157830914 18:50856244-50856266 AAGCACTTAAGAGTATAACTAGG - Intergenic
1161616701 19:5274782-5274804 AAGCACTTGCCAGAATAACTTGG + Intronic
1164111559 19:22164977-22164999 ATGTACTGACTAGTCTCACTCGG - Intergenic
1167510243 19:49891918-49891940 CAGCACTGACCAGTGGCACAGGG - Intronic
928528882 2:32170325-32170347 AAGCAGTATCCAATATCACTGGG - Intronic
931006264 2:57853058-57853080 AACCACATACCAGTATCAATGGG - Intergenic
931638835 2:64363749-64363771 CAGCTCTGCCCAGTATGACTGGG - Intergenic
932616792 2:73236987-73237009 AAGCACTTACAAGTAGCAGTTGG + Intronic
938155217 2:128931813-128931835 AACCACAGACCAGTTTCACATGG - Intergenic
939268514 2:139907964-139907986 AAGATCTTACCAGTAACACTGGG + Intergenic
1169226418 20:3859804-3859826 AAGGAGTGACAAGCATCACTTGG - Intronic
1171843173 20:30240445-30240467 AAGTAAGCACCAGTATCACTGGG - Intergenic
1172100116 20:32480314-32480336 AAGCCCTGACCAGGAGCCCTGGG + Intronic
1173160767 20:40650767-40650789 AACCACTTACCACTGTCACTAGG + Intergenic
1173352098 20:42254594-42254616 AAGCTCAGAGCTGTATCACTGGG + Intronic
1177808966 21:25904223-25904245 AAGCACTGGCTACTATCAGTTGG + Intronic
1182515686 22:30857596-30857618 AAGCATTGGCCATTATTACTTGG - Intronic
1182838239 22:33361966-33361988 AAGCTCTGGCCAGAATCAGTTGG - Intronic
1184200708 22:42967311-42967333 AAGCCCTGATCAGTAACATTGGG - Intronic
1185194309 22:49459248-49459270 CATCACTGACCAGTCTGACTTGG + Intronic
951745529 3:25973642-25973664 AAGGAATGACCTGTATCTCTAGG - Intergenic
956693244 3:71897122-71897144 AAGCATTGACGAGTATTACAAGG + Intergenic
956869854 3:73406286-73406308 AAGCACTTACCAAGGTCACTTGG - Intronic
958660845 3:97064732-97064754 AAGCACTGACCAGTATCACTTGG - Intronic
960355162 3:116643207-116643229 ATGAACTGACAAGTAACACTTGG + Intronic
962417578 3:135197152-135197174 AAGCTGTGACCAGTATCCCATGG + Intronic
966404932 3:179586903-179586925 AAGCCCTGACCAGTGCCAATGGG - Intronic
969725490 4:8915811-8915833 AAGCAGTGAGCAGAACCACTGGG + Intergenic
972074588 4:35070056-35070078 AAGCATTGACCAGTAACACAAGG + Intergenic
976876860 4:89863300-89863322 CAGCACACACCAGTATCTCTGGG - Intergenic
979601233 4:122588324-122588346 AAGAAATGCCCAGTATCCCTTGG + Intergenic
981315159 4:143334728-143334750 AGGCACTTAACAGTATCACAAGG - Intergenic
993853122 5:93036016-93036038 AAGAACTGCCCAGAAACACTAGG + Intergenic
998418038 5:141959585-141959607 AAGCCCTGACTAGTGCCACTTGG - Intronic
1005241058 6:23827656-23827678 AAGAACTCACCAGTATCATTTGG + Intergenic
1009253870 6:61350223-61350245 AAGCACTCACAAATATCCCTTGG - Intergenic
1009258556 6:61452044-61452066 AAGCACTCACAAATATCCCTTGG - Intergenic
1019219399 6:170462501-170462523 AAGCACAGACCAGCAGCACCAGG + Intergenic
1019950178 7:4365777-4365799 AAACACTGACCCCTGTCACTTGG - Intergenic
1021255926 7:18391908-18391930 AAGCATTGCCCATTATCAATAGG + Intronic
1021853093 7:24827562-24827584 AAGCATTGTCCAGTGTGACTAGG - Intronic
1024781704 7:52858276-52858298 AAGCACTCTCCAGTAACACATGG - Intergenic
1025291572 7:57730315-57730337 AAGTAAGCACCAGTATCACTGGG - Intergenic
1036980009 8:13460041-13460063 CAGCAGTGAGCAGAATCACTTGG - Intronic
1039853448 8:41392155-41392177 AAGCACTCAACAGGATCAGTGGG + Intergenic
1040359176 8:46648997-46649019 AAGCACTGAAACATATCACTTGG + Intergenic
1040569356 8:48594045-48594067 ATACACTCACCAGTGTCACTGGG + Intergenic
1047071934 8:121354833-121354855 AAGCACTAAACAGAATGACTGGG - Intergenic
1048412862 8:134193654-134193676 AAGGACTGACAAGTATGACGTGG + Intergenic
1050479837 9:6078287-6078309 AAGCACTGAAAAGTATCCATTGG - Intergenic
1052213579 9:25937349-25937371 AAGTACTGAAAAATATCACTTGG + Intergenic
1052709956 9:32042048-32042070 ACACACTGACCAGTCTCAGTAGG + Intergenic
1054164926 9:61715385-61715407 AAGTAAGCACCAGTATCACTGGG + Intergenic
1054987370 9:71278308-71278330 AAGCACAGAACATTAGCACTTGG + Intronic
1056432450 9:86541129-86541151 TAGCTCTGACCAGTTTCCCTTGG + Intergenic
1057667102 9:97054626-97054648 AAGCAGAGACCAGAGTCACTTGG + Intergenic
1062305707 9:135906346-135906368 AGCCACTGACGAGAATCACTAGG + Intronic
1186711600 X:12203586-12203608 AAACTCTCCCCAGTATCACTAGG - Intronic
1191575300 X:62697415-62697437 AAGCACTCACAAATATCCCTGGG + Intergenic
1192053425 X:67747650-67747672 AGGCACTGGCCAGGACCACTGGG - Intergenic
1194720902 X:97339172-97339194 AAGCAGTGATCAGAATTACTGGG - Intronic
1196245551 X:113394779-113394801 AAGCTCTGCCCTGTATCATTAGG - Intergenic
1198116211 X:133547485-133547507 AAGCACAGACGAGTACCATTTGG - Intronic