ID: 958663329

View in Genome Browser
Species Human (GRCh38)
Location 3:97101601-97101623
Sequence AGGTGTATCCCTGACATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958663329_958663333 19 Left 958663329 3:97101601-97101623 CCTCCAATGTCAGGGATACACCT 0: 1
1: 1
2: 1
3: 8
4: 94
Right 958663333 3:97101643-97101665 GAAGGTGTAACTTTACTTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 202
958663329_958663332 1 Left 958663329 3:97101601-97101623 CCTCCAATGTCAGGGATACACCT 0: 1
1: 1
2: 1
3: 8
4: 94
Right 958663332 3:97101625-97101647 AGCACTGAGAAACTTCTTGAAGG 0: 1
1: 0
2: 2
3: 14
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958663329 Original CRISPR AGGTGTATCCCTGACATTGG AGG (reversed) Intronic
908415853 1:63912655-63912677 AGTTGTATCCTTGACACTGTTGG + Intronic
908909758 1:69059630-69059652 AGGTGTGTTCCTGACACTGAGGG - Intergenic
909332071 1:74425562-74425584 AAATGTATTCCTGACACTGGAGG - Intronic
912386194 1:109272404-109272426 AGGTGAATCCCGGAGATGGGAGG + Exonic
912747872 1:112260508-112260530 AGCAGTGTCCCTGACATTGCTGG + Intergenic
915664771 1:157434473-157434495 AGGTGGATTCCTGAGATTTGAGG - Intergenic
917146503 1:171897451-171897473 AGGTCTATCCTTGACATTTGTGG - Intronic
917439077 1:175050661-175050683 AGGTGAATGCCTCTCATTGGTGG - Intergenic
1062824650 10:558716-558738 TGGTGATTCCCTGACATAGGCGG - Intronic
1063033721 10:2263395-2263417 AGGTGTCTCCCTGCCCTTTGAGG + Intergenic
1064951173 10:20852535-20852557 AAGTGTGTACCTGACTTTGGAGG + Exonic
1065319370 10:24494957-24494979 AGGTGTGCACCTGACACTGGGGG - Intronic
1065630461 10:27675940-27675962 AACTGAATCCCTGACATTGTGGG - Intronic
1066097474 10:32085950-32085972 AGGTGTATGCATAACTTTGGGGG - Intergenic
1067144146 10:43681555-43681577 AGGTGTCTCCCTCACAGTGCAGG + Intergenic
1067185399 10:44022871-44022893 AGGTGTTTCCCTAACCTTGGAGG + Intergenic
1069788928 10:71006999-71007021 AGGTTTATCCATAGCATTGGTGG + Intergenic
1070312393 10:75283277-75283299 AGGTGTCCCCCTGTCATGGGCGG + Intergenic
1071024306 10:81093576-81093598 GGGTGTCTCCCTGATATTGAAGG + Intergenic
1071928057 10:90434311-90434333 ATGGTTGTCCCTGACATTGGTGG + Intergenic
1073270940 10:102263348-102263370 AGGTGTACCACTTAGATTGGAGG + Intronic
1075849099 10:125573306-125573328 AGGTCAACTCCTGACATTGGTGG - Intergenic
1077862776 11:6198260-6198282 AGAAGCATCTCTGACATTGGAGG - Intergenic
1078572216 11:12469092-12469114 AAGGGTATAGCTGACATTGGTGG - Intronic
1081493878 11:43586890-43586912 AAGTGTATCTCTGAAATGGGAGG - Intronic
1082792071 11:57352962-57352984 AGTAATAGCCCTGACATTGGGGG + Intronic
1083280875 11:61626738-61626760 AGGAGTGCCCCTGGCATTGGAGG - Intergenic
1087903299 11:103666944-103666966 CAGTGTCTCTCTGACATTGGGGG - Intergenic
1092948802 12:13481147-13481169 ATGTGTATCCCTGCCTTTTGTGG + Intergenic
1097622440 12:61957065-61957087 AGGTGTATCGCTGACAGAGATGG + Intronic
1101666426 12:106819954-106819976 AGGTACATTCCTGAAATTGGTGG + Intronic
1102742372 12:115219358-115219380 ACGTGTATCCATCTCATTGGAGG - Intergenic
1103857739 12:123985369-123985391 AGGTCTATTCATGACATTTGAGG + Intronic
1106185475 13:27405954-27405976 AGGTTTCTCCCTGACATGGAGGG + Intergenic
1112639044 13:101252079-101252101 AGGTGTATACCTAAAATTTGTGG - Intronic
1122694714 14:103547027-103547049 ACGTGGCTCCCTGACCTTGGAGG - Intergenic
1127220790 15:56878582-56878604 GGGTTTATCCCTAACAGTGGTGG - Intronic
1128655200 15:69455804-69455826 AGGTGTGTCCCCTACACTGGGGG + Exonic
1129236443 15:74226460-74226482 AACTGTCTCCCTGACATTTGTGG - Intergenic
1137387068 16:48051517-48051539 AGGGATGTCCCTGACATGGGGGG + Intergenic
1139043762 16:63032025-63032047 CTGTGTATGCCTGGCATTGGTGG - Intergenic
1140906132 16:79410890-79410912 AGGTGGATACCTGACAATGAAGG + Intergenic
1141267902 16:82513464-82513486 AGGTGATTCCCTGAGATTTGTGG + Intergenic
1143441762 17:6980103-6980125 AGGTGTAACCCTGACAGCAGTGG + Intronic
1143447839 17:7019433-7019455 GGGTGCATCCCTCACATTTGGGG + Intergenic
1144254252 17:13450342-13450364 AAATGTACCCCTTACATTGGTGG + Intergenic
1147426362 17:40347693-40347715 AGGTGTCTCCCTGAGATAGGGGG - Intronic
1149432772 17:56607692-56607714 AGATGTCTCTCTGACATTTGTGG - Intergenic
1152693570 17:81732954-81732976 AGGTGTAGCCCTGGCCTGGGTGG - Intergenic
1155202607 18:23530456-23530478 AGGTTTATCCGGGGCATTGGTGG + Exonic
1157265326 18:46214655-46214677 AGTTGTATCACTCACAGTGGTGG + Intronic
1160024434 18:75206866-75206888 AGGTGGATCCCTGAATTTTGTGG - Intronic
929217534 2:39431500-39431522 AACTGTATCCCTGAAAGTGGTGG + Intronic
940190696 2:151037295-151037317 AAGTGTTTCCCTGAGTTTGGGGG + Intronic
940575426 2:155497454-155497476 AGGTGCATACCTGATTTTGGAGG - Intergenic
940882263 2:158958524-158958546 TGGCCTATCCCTGTCATTGGTGG - Intergenic
945608630 2:211970062-211970084 AGCTGTGTCCCAGACATTGTGGG + Intronic
948083458 2:235226668-235226690 AGGTGTTTCCCTGAGATCTGTGG - Intergenic
1169192735 20:3668394-3668416 AGGTGTAGCACTGGGATTGGGGG + Exonic
1170410275 20:16082096-16082118 AGGGGTATGTCTGACAGTGGTGG - Intergenic
1171088539 20:22262211-22262233 AGGGGCTTCCCTGACATGGGTGG + Intergenic
1173710014 20:45146825-45146847 GGGTGTACCCCAGGCATTGGAGG + Intergenic
1175853763 20:62107957-62107979 AGGAGTCTCCCTGACTTTGATGG - Intergenic
1182073419 22:27478760-27478782 AGGTGTCTCCCTGACTGGGGAGG + Intergenic
1182444729 22:30383391-30383413 CTGTGTATCCCTGTCATGGGTGG - Intronic
1183470218 22:38001495-38001517 CAGTGAATGCCTGACATTGGAGG + Intronic
950141713 3:10620447-10620469 GGGGGTATCCCTGTCATTTGAGG + Intronic
953956647 3:47236653-47236675 AGGTGTCCACCTGAAATTGGGGG + Intronic
954396907 3:50297866-50297888 AGGTGTCTACCCCACATTGGAGG + Intronic
956416014 3:69029987-69030009 AGGTGAATCCCAGACCTTGCTGG - Exonic
958663329 3:97101601-97101623 AGGTGTATCCCTGACATTGGAGG - Intronic
965726649 3:171724145-171724167 AGGTGAATCCCTGGAATTGCTGG + Intronic
967229842 3:187327133-187327155 AGGTGTATCCCTGACAGTGGAGG + Intergenic
975183120 4:71369828-71369850 AGGTGATTCCCTGTCCTTGGGGG + Intronic
981079490 4:140624591-140624613 AAGTATAACCCTGACATTAGAGG + Intronic
982532631 4:156565422-156565444 AGGTGTATTTCTGAGATGGGAGG + Intergenic
986227185 5:5826745-5826767 AGGAGAATACCTGACAGTGGAGG + Intergenic
990007269 5:50958324-50958346 AGGTCTCTCCCTAACATTGCTGG - Intergenic
994676973 5:102835380-102835402 AAGAGTATATCTGACATTGGTGG + Intronic
1001690574 5:173629753-173629775 AGGGGTAACCCTGAGGTTGGGGG - Intergenic
1005592049 6:27338651-27338673 AGGAGTATGCCTGACATTTGAGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1009273154 6:61641119-61641141 AGGTGCATCTCTGACAATGGAGG - Intergenic
1011020627 6:82808960-82808982 AGGTGGGTCCCTAACACTGGTGG - Intergenic
1013431635 6:110061546-110061568 AGGTATATCCCTGACAAAAGGGG + Intergenic
1014177949 6:118350497-118350519 ATGTGTGTCACTTACATTGGTGG - Intergenic
1018196684 6:161361593-161361615 GGTGGTATCCCTGACAGTGGTGG + Intronic
1018950874 6:168378104-168378126 GGGTGTATCCCTGACAGCTGGGG - Intergenic
1019429923 7:994028-994050 AGGGCCCTCCCTGACATTGGGGG - Intergenic
1026328932 7:69335399-69335421 AGGTTTATCTCAGACATGGGTGG - Intergenic
1030464414 7:109881876-109881898 AGGTGTATTCCAGGTATTGGAGG + Intergenic
1030709954 7:112738541-112738563 AGTGGTAGCCCTGACATTGAAGG + Intergenic
1035427106 7:158785477-158785499 AGGTTTAGTCCTGACACTGGAGG - Intronic
1038583604 8:28770710-28770732 AGGTGCAGCCCTGCCCTTGGGGG - Intronic
1043292009 8:78613582-78613604 AGGTGTCTCTCTGATATTTGGGG - Intergenic
1046243456 8:111528628-111528650 AGGTCCATCTCTAACATTGGAGG + Intergenic
1046660154 8:116939727-116939749 AGGTGTTTCTTTGACATTGTTGG - Intronic
1047950568 8:129930792-129930814 AGGTGGATCCCTGAAAATGAGGG - Intronic
1049244577 8:141555329-141555351 AGGTGTATCCATGGTGTTGGAGG + Intergenic
1053487462 9:38470719-38470741 AGTTGTATGCCAGACATTGTTGG - Intergenic
1057189617 9:93079411-93079433 AGGTGTATCCCTGACGGTGGTGG - Intronic
1057210650 9:93199297-93199319 AGGACTATCCTTGACATTGGGGG - Intronic
1061193101 9:129093703-129093725 AGGTGTAGCCCAGACAATGGAGG - Intergenic
1192832794 X:74767831-74767853 AGGTGTAACACTGCTATTGGTGG + Intronic
1199363610 X:146951573-146951595 TGGTGTATCAGTGACTTTGGTGG - Intergenic