ID: 958664603

View in Genome Browser
Species Human (GRCh38)
Location 3:97119924-97119946
Sequence AGTCTCAGCATTCAAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958664603_958664606 -6 Left 958664603 3:97119924-97119946 CCCTCCTTTTGAATGCTGAGACT 0: 1
1: 0
2: 1
3: 29
4: 325
Right 958664606 3:97119941-97119963 GAGACTCATTTGCTGAATTCCGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958664603 Original CRISPR AGTCTCAGCATTCAAAAGGA GGG (reversed) Intronic
902253908 1:15175002-15175024 AGTGTCAGCGACCAAAAGGATGG - Intronic
907894978 1:58679705-58679727 TGTCTCAGCCTCCAAAAGCACGG + Intronic
908437370 1:64119892-64119914 AGTCACAGCATCCAAGAGCAAGG - Intronic
909961119 1:81843649-81843671 ACTATCAGCATTCAAGATGAAGG + Intronic
910504368 1:87932882-87932904 ATTCTCAGCATTCAATATGTTGG + Intergenic
912224527 1:107718357-107718379 AGTCTCAGGATACAAAATCAAGG + Intronic
912280444 1:108307710-108307732 TGTCTCAGCATTGAAAAGTTAGG + Intergenic
912287782 1:108386647-108386669 TGTCTCAGCATTGAAAAGTTAGG - Intronic
913542046 1:119830791-119830813 AGTCTCATCCCTCCAAAGGATGG + Intergenic
913721419 1:121600035-121600057 AGTCTCAGGATACAAAATCAAGG - Intergenic
917680443 1:177360792-177360814 AGTCCCAGCATTCACAAGCCTGG - Intergenic
918085225 1:181239423-181239445 AGTCTCAACCTTTAACAGGAAGG - Intergenic
918570524 1:185986384-185986406 AGTCTCATCTTTCCAGAGGATGG + Intronic
919111402 1:193223602-193223624 AGTCTCAGCTTTATAAGGGAAGG + Intronic
919358723 1:196562345-196562367 TGTGCCTGCATTCAAAAGGAAGG + Intronic
919410932 1:197242030-197242052 AGTCTCAGGATACAAAATCAAGG - Intergenic
920416661 1:205803486-205803508 TTTCTCAGCCTTAAAAAGGAAGG + Intronic
920965146 1:210695081-210695103 AGTGTCAGCATTCTAAAGAGAGG - Intronic
921062622 1:211598534-211598556 AGTATAAACATTCAAAAGCAAGG - Intergenic
921276440 1:213525328-213525350 AGGCTTAGCAATCAGAAGGATGG + Intergenic
921429160 1:215043454-215043476 TTACTCAGCCTTCAAAAGGAAGG + Intronic
923556925 1:235008477-235008499 TGATTCAGCCTTCAAAAGGAAGG + Intergenic
924254942 1:242173204-242173226 AGTCTCAGGATACAAAATCAAGG + Intronic
924398502 1:243651234-243651256 AGTCTCAGGATACAAAATCAAGG - Intronic
1063224573 10:4003665-4003687 AGTCTCAGTAATCAGAAGGATGG + Intergenic
1063743060 10:8846385-8846407 TGCCTCAGCCTTCCAAAGGAAGG - Intergenic
1065385272 10:25127828-25127850 ATTCTCAGCCTTTAAAGGGAGGG - Intergenic
1065795374 10:29302707-29302729 AGCCTCAGCATTCACACTGAAGG - Intronic
1066271622 10:33829693-33829715 AGTCTCAGGATATAAAAGGCAGG - Intergenic
1067009551 10:42697563-42697585 ACTCTCAGAATACAAATGGATGG + Intergenic
1068629643 10:59286073-59286095 TTGTTCAGCATTCAAAAGGAAGG + Intronic
1068650242 10:59514628-59514650 TGTCTCTTCGTTCAAAAGGAGGG - Intergenic
1068971954 10:62968275-62968297 TCTCTCGGCACTCAAAAGGAAGG + Intergenic
1071011657 10:80947531-80947553 AGTCACAGGATACAATAGGAAGG - Intergenic
1071564101 10:86662704-86662726 AGTGTCAGCATGGAAAAGGATGG - Intronic
1072230546 10:93410757-93410779 AGTTTCAGAATCCAAAAGCAGGG - Intronic
1072568663 10:96639771-96639793 AGCCTCAGCAGTCACAGGGAGGG + Intronic
1074174513 10:110983344-110983366 AGTCCAAGCAAGCAAAAGGAAGG - Intronic
1075296497 10:121281052-121281074 AGTCTCAGCAGACAAAAGAAGGG - Intergenic
1075446270 10:122515656-122515678 ACTGTCAGCAGTTAAAAGGAGGG + Intergenic
1076211390 10:128648400-128648422 TTACTCAGCATTAAAAAGGAAGG - Intergenic
1076718540 10:132381571-132381593 AGTCTCTTCAAACAAAAGGAAGG + Intergenic
1076940269 10:133601013-133601035 AGTCACAGTATGCATAAGGAAGG - Intergenic
1079542847 11:21596431-21596453 AGTCTCAGTATACAAAATCAAGG + Intergenic
1079908332 11:26277549-26277571 AATCTCAGGATTCAAAATGAAGG - Intergenic
1080508153 11:32938971-32938993 AGTTTCAGGATTCAAAACTAGGG - Intronic
1081380584 11:42409709-42409731 AGTCTTAGGATTCCAAAGAAAGG - Intergenic
1081646150 11:44792009-44792031 AGTGTCAGCTCTCCAAAGGAGGG - Intronic
1082743840 11:56940902-56940924 AGTCTCAGGATACAAAATCAAGG - Intergenic
1084309378 11:68307923-68307945 AGTTTCTGCATTCAAAAAGTGGG - Intergenic
1085443097 11:76580578-76580600 AGTCGCAGCATCCCAGAGGAGGG + Intergenic
1086086836 11:82964145-82964167 AGTCTCAGGATACAAAATGATGG - Intronic
1086475348 11:87167147-87167169 AGTCTCAGGATACAAAATCAAGG - Intronic
1086543927 11:87946193-87946215 AGTCTCAGCCTTCAAGTGGCAGG - Intergenic
1087719518 11:101646338-101646360 AGTCTCAGAATACAAAATCAAGG + Intronic
1089507901 11:118976859-118976881 TGAATCAGCATTCACAAGGAGGG - Intronic
1091282035 11:134387275-134387297 ACTCTCAGCACCCAAGAGGAGGG - Intronic
1091868630 12:3867562-3867584 ATTCTCAGCATTAAAAATCAGGG - Intronic
1093121668 12:15278192-15278214 AGGCTCAGTATTATAAAGGAGGG - Intronic
1094671847 12:32578405-32578427 AGTCTAAGCTCTCATAAGGAAGG - Intronic
1095067110 12:37791209-37791231 AGTCTCAGGATACAAAATCAAGG + Intergenic
1095165309 12:38965304-38965326 AGTCTCAGGATACAAAAGCAGGG - Intergenic
1095615400 12:44182195-44182217 AGTCTCAGGATACAAAATCAAGG - Intronic
1095746850 12:45669134-45669156 TGACTCAGCATTCAATAGTATGG + Intergenic
1098859927 12:75697168-75697190 AATCTCTGAATTCAAAAGGGAGG + Intergenic
1099116500 12:78632258-78632280 AGTTTCATCATTCAAAAGCATGG + Intergenic
1099957516 12:89365115-89365137 ACTTTCAAGATTCAAAAGGATGG + Intergenic
1100320838 12:93490779-93490801 AGTTACAGCAGTCAAAAGAATGG + Intronic
1100871019 12:98910130-98910152 AGTATTAGAATTCAAAAGGAGGG + Intronic
1104168368 12:126255886-126255908 TATCTCACCCTTCAAAAGGAGGG - Intergenic
1104886165 12:132109931-132109953 TGACTCAGCCTTCAAAAGGAAGG - Intronic
1105089374 13:16259565-16259587 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105089514 13:16262467-16262489 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105089670 13:16265377-16265399 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105089748 13:16266741-16266763 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105089909 13:16269645-16269667 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105090069 13:16272549-16272571 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105090225 13:16275460-16275482 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105090539 13:16281276-16281298 AATCTGCTCATTCAAAAGGAAGG - Intergenic
1105306111 13:19170183-19170205 AGCCTCATCACTCAAAAGGTAGG - Intergenic
1105405984 13:20133080-20133102 AGATTCAGCCTTAAAAAGGAAGG - Intergenic
1105778908 13:23689489-23689511 TCACTCAGCCTTCAAAAGGAAGG + Intergenic
1106231619 13:27825305-27825327 AGTCTCAGATTTCAAAAGCAAGG - Intergenic
1107356540 13:39573324-39573346 GGTCTTAGCCTTCGAAAGGAAGG + Intronic
1109061882 13:57631288-57631310 AGTCTCTGCATTCACAGGGCTGG - Intergenic
1111042110 13:82761537-82761559 AGTTTCAGAATACAAAATGAAGG + Intergenic
1111130397 13:83967742-83967764 TGTCTCTGCATTAAAAAGGCTGG - Intergenic
1111989275 13:95100679-95100701 AGTCACTGCATTTACAAGGATGG - Intronic
1112055548 13:95687214-95687236 AGTCTCAGTATACAAAACCATGG - Intronic
1112062488 13:95755195-95755217 TGTCTCAGCCTTCCAAAGCACGG - Intronic
1114124104 14:19704632-19704654 AGTCTCAGGATACAAAATCAAGG - Intergenic
1114335888 14:21689668-21689690 AGTCTCAGGATACAAAATCAAGG - Intergenic
1115423417 14:33224503-33224525 AACCTCAGCATTCTAAAGGAAGG + Intronic
1116305919 14:43256031-43256053 GGTCTCAGCATACAAAATCAAGG + Intergenic
1116996273 14:51328457-51328479 ACTCTCAGCATTCTAGAGGGAGG - Intergenic
1117624495 14:57620967-57620989 AGTCTCAGGATACAAAATCAAGG + Intronic
1117934586 14:60888748-60888770 AGTCTCAGGATACAAAATCAAGG + Intronic
1119485385 14:74983516-74983538 TTACTCAGCATTTAAAAGGAAGG + Intergenic
1119520663 14:75282405-75282427 AATCTTAGCATTCCAATGGAAGG - Intergenic
1121656557 14:95601154-95601176 AGTCTAGGCAATAAAAAGGATGG - Intergenic
1122443806 14:101754510-101754532 AATATCAGCCTTAAAAAGGAAGG + Intergenic
1125772695 15:42181235-42181257 AGGTTCAGCCTTAAAAAGGAAGG + Intronic
1125970295 15:43905944-43905966 AATCTCCGCTTTCAAAAGGAAGG + Exonic
1126182469 15:45799004-45799026 AGTTTCAGAATGCACAAGGAAGG - Intergenic
1127722861 15:61719916-61719938 ATTCCCAGCCTTCACAAGGAAGG - Intergenic
1127780000 15:62304070-62304092 ATTTTTAGCATTAAAAAGGAAGG - Intergenic
1130397901 15:83520452-83520474 AGTTTCAGCATAGAAAATGACGG - Intronic
1132069551 15:98763723-98763745 AGTCTAAGCATTCAAAATGAAGG - Intronic
1132209066 15:100007199-100007221 GGGCTCAGCATTCAGACGGAGGG + Intronic
1132238995 15:100243160-100243182 TTACTCAGCCTTCAAAAGGAAGG - Intronic
1133690559 16:8210491-8210513 TGCCTAAGCATTCAACAGGAGGG - Intergenic
1133777230 16:8906259-8906281 AATCTCAGCAATTAAATGGATGG + Intronic
1135475410 16:22770294-22770316 AGTCACAGTATTCAATAGGGAGG + Intergenic
1136992944 16:35167711-35167733 AGTCTCAGGATACAAAATCAAGG + Intergenic
1138150910 16:54656011-54656033 TCTCTCAGGATACAAAAGGAAGG + Intergenic
1139963661 16:70732758-70732780 AATCTCAGCACTCAAGAGGCTGG - Intronic
1142896631 17:2983806-2983828 AACCTCAGCAATAAAAAGGAGGG - Intronic
1144160103 17:12549494-12549516 ATTCTCAGCCTGAAAAAGGAAGG - Intergenic
1146658666 17:34650189-34650211 AGTCTGAGCAATCAAAGGCAGGG - Intergenic
1146717929 17:35101707-35101729 ACACTCAGCCTTTAAAAGGAAGG + Intronic
1148230063 17:45927201-45927223 ATTTTCAGCATTCCAATGGAGGG - Intronic
1148567539 17:48642447-48642469 AGTCCCAGCAGTCCAGAGGAGGG - Intergenic
1149160936 17:53691956-53691978 AGAGTCAGCATTAAAAAGCAAGG - Intergenic
1149365851 17:55943252-55943274 AGTCTCAGGATACAAAATCAAGG + Intergenic
1150297685 17:64022120-64022142 TTGCTCAGCCTTCAAAAGGAAGG - Intergenic
1150297891 17:64023723-64023745 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
1150535288 17:66032312-66032334 AGTCTTAGCATTCACAGGGCAGG + Intronic
1151042984 17:70885446-70885468 AGTTTCAGCTGTCAAAAAGAAGG - Intergenic
1151300990 17:73225681-73225703 AGTCTTACAATTCAAAAGAATGG + Intronic
1152652340 17:81500585-81500607 TTTCTCAGCTTTAAAAAGGAAGG + Intergenic
1153160772 18:2202705-2202727 AGCCTGACCATTCAGAAGGAGGG - Intergenic
1153487172 18:5611302-5611324 TTACTCAGCCTTCAAAAGGAAGG + Intronic
1153903065 18:9636194-9636216 AGACTCAGCTTTTAAGAGGAAGG + Intergenic
1154373509 18:13788511-13788533 AGTCTCATCATTAAATATGATGG + Intergenic
1155695696 18:28683074-28683096 AGTCTAGGCATTAACAAGGATGG - Intergenic
1159059098 18:63495854-63495876 AGCATCTGCATTCAAAAGAAGGG - Intronic
1159060873 18:63512627-63512649 AGTCTCAGTAGTTGAAAGGAGGG + Intergenic
1163349689 19:16768304-16768326 ATTCTTAGCCTTGAAAAGGAAGG - Intronic
1164556502 19:29256735-29256757 AGCCTCAGCCTTGAAAAGCAGGG + Intergenic
1167957669 19:53080067-53080089 AGTCTCAGGATTTAAAATCAAGG + Intronic
1168518911 19:57032971-57032993 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
925053746 2:838876-838898 AGTCTCAGGATACAAAATCAAGG + Intergenic
926648963 2:15320548-15320570 AGTCTCAGGATACAAAATCAAGG + Intronic
927049194 2:19310005-19310027 AGTCTCAGGATACAAAATCAAGG + Intergenic
927106517 2:19832250-19832272 AGTCTCAGGATACAAAATCAAGG - Intergenic
927417825 2:22897406-22897428 AGCCTCAGCAAACAAAAGCATGG - Intergenic
928178187 2:29049308-29049330 TTTTTCAGCCTTCAAAAGGAAGG - Intronic
928314847 2:30237082-30237104 AGCCTGAGCATGCAAAGGGAAGG - Intronic
928892862 2:36225351-36225373 AGTCTCAGCTTTGAACAGTAAGG - Intergenic
930327564 2:49939455-49939477 AGTTTCAGAATACAAAAGGATGG - Intronic
931203431 2:60123498-60123520 AGTCTCAGCAACCATAAGGATGG - Intergenic
932011018 2:67977307-67977329 ATTCTCAGTATAGAAAAGGAAGG - Intergenic
932679691 2:73814258-73814280 AATGTCAGCGTTGAAAAGGAGGG + Intronic
933331367 2:80896730-80896752 TGTCTCAGCATTCACACCGAGGG + Intergenic
933801353 2:85962492-85962514 ATTCTCAGCAATCTAAAGGTAGG - Intergenic
935845235 2:107159013-107159035 AGTCTCAAAACTCAAAAAGAGGG + Intergenic
939022512 2:136976027-136976049 AGTCTCAGGATACAAAATCAAGG - Intronic
940036048 2:149312985-149313007 AGTCTCAGCTCTGAACAGGAGGG + Intergenic
940292147 2:152087521-152087543 AGTCACAGTATTGAATAGGATGG - Intronic
942757003 2:179353013-179353035 ATTATCAGCCTTAAAAAGGAAGG - Intergenic
943013656 2:182483739-182483761 AGCCTAAGCAAGCAAAAGGAAGG + Intronic
944373090 2:199009543-199009565 AGTCTCAGGATACAAAATCAAGG - Intergenic
945160246 2:206883123-206883145 TGTCTCTGCACTCAAAAGGAAGG + Intergenic
946757795 2:222964539-222964561 AGCCTCAGCGTTCAGAAGGCAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947515823 2:230803556-230803578 AGTCTCAGGATACAAAATCAAGG + Intronic
947864555 2:233387319-233387341 AGCCTCAGCATGGAAATGGAGGG - Intronic
1169114539 20:3055064-3055086 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
1171276917 20:23864762-23864784 AGTTTCAGGATTCAAAATCAAGG - Intergenic
1173582258 20:44155567-44155589 AGTGTCTGAATTCCAAAGGATGG + Intronic
1174227443 20:49013513-49013535 AAACTAAGCATGCAAAAGGAAGG - Intronic
1174550183 20:51356474-51356496 AGTCTCAGCCTTAGAAGGGAAGG + Intergenic
1176320258 21:5310218-5310240 AATCTGTTCATTCAAAAGGAAGG - Intergenic
1176422698 21:6528708-6528730 AATCTCAGTTTTAAAAAGGAAGG + Intergenic
1177343279 21:19833962-19833984 ACTCTCTGCATTCAAAGGAAAGG + Intergenic
1179144834 21:38758875-38758897 AGTCTCACCCCTCAAAAGGCTGG - Intergenic
1179698191 21:43137024-43137046 AATCTCAGTTTTAAAAAGGAAGG + Intergenic
1180847202 22:18990364-18990386 TTACTCAGCCTTCAAAAGGAGGG - Intergenic
1180936448 22:19628376-19628398 ATTCTCAACAGCCAAAAGGAGGG - Intergenic
1181405330 22:22680468-22680490 AGTCTCACCATGCACAAGGGAGG + Intergenic
1182077679 22:27506045-27506067 AATCTCAGGATTCAAAGAGATGG - Intergenic
1182157411 22:28087812-28087834 AGTCTCAGGATACAAAATCAAGG + Intronic
1183179968 22:36253442-36253464 TGTCTCAGCAGTCAAAACCAGGG - Intronic
1184355423 22:43976412-43976434 AATTTCAGCTTTCAAAAAGAAGG + Intronic
1184590418 22:45478348-45478370 AGTCCCAGCAGTCAGACGGATGG - Intergenic
1184733287 22:46382706-46382728 TTACTCAGCCTTCAAAAGGAGGG + Intronic
1184761147 22:46545259-46545281 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
1184915358 22:47565132-47565154 AGTCCCAGCTTTCAAAATGCTGG - Intergenic
1185186879 22:49406622-49406644 TGCCTTACCATTCAAAAGGATGG - Intergenic
952033383 3:29171551-29171573 AATCATGGCATTCAAAAGGAAGG - Intergenic
952257868 3:31710988-31711010 GGTCTCAGCATTCAACAGGCTGG + Intronic
953188460 3:40660810-40660832 TGTCTCTGCCTTTAAAAGGATGG - Intergenic
955774602 3:62420042-62420064 ACTCTCAACATACAAAAGCATGG + Intronic
955798559 3:62662862-62662884 GGTCTCAGCGTTCAAAGAGAAGG - Intronic
956590778 3:70912438-70912460 ATATTCAGCCTTCAAAAGGAAGG - Intergenic
957535933 3:81503592-81503614 AGTGACAGTATTCAAAAGTAAGG + Intronic
957608440 3:82434798-82434820 AGTCTCAGGATACAAAATCAAGG - Intergenic
957880938 3:86212278-86212300 AGTGTCAGCATGCAAAGGGGAGG + Intergenic
958664603 3:97119924-97119946 AGTCTCAGCATTCAAAAGGAGGG - Intronic
959130977 3:102355802-102355824 AGTCTAAGAGTTCAAAAGCAAGG + Intronic
959474856 3:106797354-106797376 AGAGTCAGCATTCCCAAGGAGGG + Intergenic
959843274 3:111002892-111002914 AGTCTCAGGATACAAAATCAGGG + Intergenic
959857551 3:111176893-111176915 TGTCTCATCTTTCAATAGGAAGG + Intronic
959892903 3:111576589-111576611 AGTCACAGCATCAAAAAGCAAGG - Intronic
960043137 3:113170467-113170489 AGTCTCAGCGTCCCAGAGGATGG + Intergenic
960305216 3:116052198-116052220 AGTGTCAGCAATGAAAAGAAAGG + Intronic
960508471 3:118521053-118521075 AGTCTCAGGATACAAAATCAAGG + Intergenic
961198597 3:125025489-125025511 AGTATAAGCTTTTAAAAGGATGG + Intronic
961381756 3:126500120-126500142 AGTCTCAGCCATCAACAGGTTGG - Exonic
964559574 3:157979094-157979116 ATTCTCAGCATGAAAATGGAAGG + Intergenic
966215148 3:177494248-177494270 AATCTCAGCATTAAATAAGAAGG - Intergenic
966284066 3:178272361-178272383 AGGTTAAGCATTCAAAGGGAAGG + Intergenic
967491550 3:190097190-190097212 ATTCTCACCATTCAAAAGCAAGG + Intronic
967851118 3:194083468-194083490 AGCCTCAGGATTCAAGAGGCCGG + Intergenic
969873301 4:10117628-10117650 AGTCTCATCTTTCAGTAGGATGG + Intergenic
972061890 4:34884959-34884981 ATTCACAGCCTTAAAAAGGAAGG - Intergenic
972118154 4:35664490-35664512 TGTCTCAGGATACAAAAAGAAGG + Intergenic
973193225 4:47410398-47410420 AGAATCAACTTTCAAAAGGAAGG + Intronic
973564154 4:52167051-52167073 AGTCTCAGGATACAAAATCAAGG - Intergenic
973736966 4:53881274-53881296 AGTCTCAGGATACAAAATCAAGG + Intronic
973746682 4:53970288-53970310 AGTCTCAGGATACAAAATCAAGG - Intronic
973753317 4:54045950-54045972 AGTCTCAGGATACAAAATCAAGG + Intronic
975914717 4:79310595-79310617 AGCCACAGCTTTCAAAAGAAAGG - Intronic
976450994 4:85190854-85190876 AGTCTCAGGATACAAAATCACGG - Intergenic
977517102 4:98034252-98034274 AGTCTCAGGATACAAAATCAAGG + Intronic
977697740 4:99985515-99985537 ACTTTCAGCCTTAAAAAGGAAGG + Intergenic
978139474 4:105301368-105301390 AGTCTCAGGATACAAAATCAAGG + Intergenic
978494396 4:109343854-109343876 AGTCTCAGGATACAAAATCAAGG + Intergenic
979160375 4:117452361-117452383 AGTCTCAGGATACAAAATCAAGG + Intergenic
979227306 4:118301903-118301925 GGTATCAGTATTGAAAAGGAAGG - Intronic
980028172 4:127791419-127791441 AGTCCCTGCATTCAAACGGTTGG + Intronic
980807531 4:137833058-137833080 CTTCTCAGCCTTCAAAATGATGG - Intergenic
981278532 4:142930349-142930371 AGTCTCAGGATACAAAATCAAGG - Intergenic
981578887 4:146232582-146232604 ACCCTCATTATTCAAAAGGAAGG + Intergenic
981785718 4:148477355-148477377 CCTCTCTGCATTCTAAAGGATGG + Intergenic
982265589 4:153535484-153535506 TGTCTCTGCATTCAGAAGGGTGG + Intronic
983687426 4:170428552-170428574 AGTGTCAGCTTTCAAATGCAAGG - Intergenic
983699666 4:170576818-170576840 AGTGACAGGATTCCAAAGGAGGG - Intergenic
987119985 5:14758083-14758105 TGACTCAGCCTTAAAAAGGAAGG + Intronic
987242072 5:16010341-16010363 AGTCTTAGCATTACAAAGAACGG + Intergenic
987886777 5:23823522-23823544 AGAATCTGCATTCAAAAAGATGG + Intergenic
988393087 5:30661107-30661129 AGTTTTACCATTAAAAAGGAAGG - Intergenic
992814430 5:80422137-80422159 AGTCTCAGGATACAAAATTAAGG - Intronic
993492982 5:88574376-88574398 AGTCTGAGGGTTCAAAAAGAGGG - Intergenic
993865008 5:93183733-93183755 AGTTTCAGAACTCCAAAGGAAGG + Intergenic
994383174 5:99096080-99096102 AGTCTCAGTAGTCAGAAGCAGGG + Intergenic
996075200 5:119184809-119184831 ACATTCAGCATTAAAAAGGAAGG - Intronic
996580683 5:125029087-125029109 ATTCTCAGCATTCATGGGGAAGG + Intergenic
996835245 5:127784490-127784512 GGTCTCAGCTTTAAAAAGGGAGG + Intergenic
996940991 5:129005214-129005236 AGTCAGAGCATTCAAAAGCATGG - Intronic
998458492 5:142292207-142292229 AGTCTCTGCATCTAAAAGGAGGG - Intergenic
998749119 5:145297769-145297791 AGTCTCAGGATACAAAATCAAGG + Intergenic
998763153 5:145454580-145454602 AGTCTCAGGATACAAAATCAAGG + Intergenic
999510734 5:152248785-152248807 AGTCTCAGCATTGGAAGAGATGG + Intergenic
999841554 5:155432947-155432969 AGTCTCCTCATTCATAAGAAGGG - Intergenic
1000582492 5:163051140-163051162 AGTCTCAGGATACAAAATCAAGG + Intergenic
1002083687 5:176754734-176754756 CGACTCAGCAATAAAAAGGAAGG + Intergenic
1002340576 5:178514242-178514264 AGTGTCAGCCTTAAAAAGGAAGG - Intronic
1002360656 5:178668056-178668078 CATGTCAGCCTTCAAAAGGAAGG + Intergenic
1002400220 5:178987467-178987489 CGATTCAGCCTTCAAAAGGAAGG + Intronic
1003049773 6:2768836-2768858 AATCTCATCAATAAAAAGGATGG - Exonic
1004983684 6:21056364-21056386 AGTCTCAGGATACAAAATCAAGG - Intronic
1004984344 6:21063824-21063846 GGTTTCAACATTCAAAAGAAAGG + Intronic
1005003873 6:21269220-21269242 AGTGTCATCATTCAAGAGGGTGG - Intergenic
1005353990 6:24964473-24964495 ATACTCAGCAATAAAAAGGAGGG - Intronic
1006815066 6:36844625-36844647 ACTCACAGCATTGATAAGGAGGG + Intergenic
1007736307 6:43984439-43984461 AGGCCGAGCATTCAATAGGATGG + Intergenic
1008557518 6:52688728-52688750 AGTTGCAGCATTCAAAAGTCAGG - Intergenic
1008829426 6:55739818-55739840 AGTCTCAGGATACAAAATCAAGG + Intergenic
1009186742 6:60583149-60583171 AGTCTCAGGATACAAAATCAAGG + Intergenic
1009731645 6:67615499-67615521 AGTCTCAGGATACAAAATCAAGG + Intergenic
1011012609 6:82719003-82719025 AGTCTCAGGATACAAAATCAAGG + Intergenic
1011916942 6:92518272-92518294 ATACTCAGCTTTCAAAAAGAAGG - Intergenic
1013803098 6:113970113-113970135 TTTCTCAGGATTCAAATGGAAGG - Intronic
1013967319 6:115970591-115970613 AGTCTCATTATTAAAAAGCAAGG + Intronic
1014481058 6:121937062-121937084 AGTCTCAGCATACAAAATCAAGG - Intergenic
1014511310 6:122325897-122325919 AGTCTCAGGATACAAAATCAAGG + Intergenic
1015275476 6:131379384-131379406 AGTATTAGCATTGAAAAGGAAGG + Intergenic
1015429760 6:133117310-133117332 AGTTTCAGAGTTTAAAAGGATGG - Intergenic
1015492483 6:133842110-133842132 AGTGTCAGCATTATAAAGCATGG + Intergenic
1015669383 6:135671557-135671579 ATTATCAGCCTTAAAAAGGAAGG + Intergenic
1018055937 6:160052235-160052257 AGTCTCAGGATACAAAATCAAGG + Intronic
1018891770 6:167987924-167987946 GTTCTCAGAATTTAAAAGGAAGG + Intergenic
1019650583 7:2155640-2155662 TTACTCAGCCTTCAAAAGGAAGG - Intronic
1019748794 7:2715975-2715997 AGCCCCTGCATTCACAAGGATGG + Exonic
1019819334 7:3229986-3230008 AGTCTCAGCACTGAAATAGAAGG - Intergenic
1020544375 7:9505401-9505423 AATCTAAGCATTAGAAAGGAGGG - Intergenic
1020594259 7:10184433-10184455 AGTATCATCAATAAAAAGGATGG + Intergenic
1020659130 7:10961912-10961934 AGTCTCAGGATACAAAATCAAGG - Intergenic
1022139076 7:27476489-27476511 AGTCAAAGCATTCAAAAGGGAGG + Intergenic
1023089859 7:36607774-36607796 AGTCTCAGCCAGCAAGAGGAAGG - Intronic
1023224445 7:37954269-37954291 AGTCTCAGCATTCAAGGAGTGGG + Intronic
1023873676 7:44275881-44275903 AGGGTCAGCCTTCAACAGGATGG - Intronic
1026341945 7:69442038-69442060 TGACTCAGCCTTCAAAAGGAAGG - Intergenic
1026406472 7:70071306-70071328 AGTCTCATCAGCCAAGAGGAAGG + Intronic
1026468449 7:70674340-70674362 TGTCTCAGAAATCAAAAGGAAGG + Intronic
1027804286 7:82796586-82796608 AATTTCAGCATTGAAAAGCATGG - Intronic
1028384909 7:90244260-90244282 AGTCTAAGCCCTCAAAGGGAGGG + Intergenic
1029012912 7:97281626-97281648 AGTCTTAGCATTTGAAAGCAGGG + Intergenic
1029221305 7:98992789-98992811 AGACTCAGCATTGAAAACAAGGG - Intronic
1029895253 7:103976801-103976823 AGTCCCAGCAATCAAGAGGTCGG + Intronic
1032468799 7:132163538-132163560 AGGCTTAGCATTCAAGAGCATGG - Intronic
1033102535 7:138487179-138487201 AGTCTCAGGATACAAAATCAAGG - Intronic
1033412536 7:141132093-141132115 AGCCTCAGCACTCAAAACGAAGG - Intronic
1035018344 7:155785721-155785743 TGACTCAGCCTTGAAAAGGAAGG - Intergenic
1035856434 8:2981054-2981076 AGCCTCAGAATTAAATAGGAAGG - Intronic
1036215552 8:6877243-6877265 AGTCTCCCCAGTCAATAGGAGGG - Intronic
1038564294 8:28606856-28606878 TTACTCAGCCTTCAAAAGGAAGG - Intronic
1038602587 8:28961535-28961557 TGTCCCAGCCTTTAAAAGGAAGG - Intronic
1039019477 8:33189147-33189169 AGTCTCAGGATACAAAATCAAGG + Intergenic
1040549279 8:48426193-48426215 TGGCTCAGCCTTGAAAAGGAAGG + Intergenic
1040668800 8:49661697-49661719 AGTCTCAGTATACAAAATTAAGG + Intergenic
1042339276 8:67661943-67661965 TGACTCAGCCTTAAAAAGGAAGG - Intronic
1042493055 8:69423780-69423802 ATTTTCAGCATTCAAAAAAAAGG - Intergenic
1042661801 8:71162485-71162507 AGTCTCAGAAAGCAGAAGGATGG + Intergenic
1044601048 8:94005470-94005492 AGTCTCAGGATACAAAATCAAGG - Intergenic
1044630434 8:94273070-94273092 AATCTAAGCATACAAATGGATGG - Intergenic
1044708550 8:95032550-95032572 TGTCTAAGAATTCCAAAGGAAGG + Intronic
1044712628 8:95072320-95072342 AGCCTCAGCCTTGAAAAGTAAGG - Intronic
1045634526 8:104168505-104168527 AGTCTCAGGATACAAAATCAAGG - Intronic
1045687758 8:104728979-104729001 AATCTGAGCCTTTAAAAGGAGGG - Intronic
1047136808 8:122088581-122088603 GGTCTCAGCATTTTAAAGGCTGG - Intergenic
1048696745 8:137036805-137036827 AGTCTCAGGATACAAAATCAAGG - Intergenic
1048748852 8:137648096-137648118 AGTCTCATCAGACCAAAGGAAGG + Intergenic
1051121596 9:13758135-13758157 ATCCTCAGCATTTAAAAGGATGG - Intergenic
1051354758 9:16231444-16231466 AATCTCAACAGTCAAAAGAATGG - Intronic
1051751539 9:20347531-20347553 AGTCTCAACATTAAGAATGAAGG + Intronic
1052127123 9:24791083-24791105 AGTCTCAGGATACAAAATGAAGG + Intergenic
1052582555 9:30377712-30377734 ATACTCAGCAATAAAAAGGAAGG + Intergenic
1055678375 9:78689327-78689349 AATCACAGCAGTCAAGAGGAAGG + Intergenic
1055689553 9:78815013-78815035 ACTCAAAGCATTCAAAATGAGGG + Intergenic
1057292764 9:93818056-93818078 AGACTCATCTGTCAAAAGGAAGG + Intergenic
1058180832 9:101796378-101796400 ATATTCAGCATTAAAAAGGAAGG + Intergenic
1058689660 9:107508751-107508773 AGTGTCAGGATTCATGAGGATGG + Intergenic
1059634968 9:116161327-116161349 GTTCTCAGGATGCAAAAGGAGGG + Intronic
1060239417 9:121890032-121890054 AGACTCAGCCTTTAAAAGGAAGG - Intronic
1061252963 9:129437382-129437404 GGTTTCAGCATTTAAAAGAAAGG + Intergenic
1061623593 9:131827334-131827356 TGACTCAGCCTTAAAAAGGAAGG + Intergenic
1185852951 X:3506389-3506411 AGACTCATTTTTCAAAAGGAGGG - Intergenic
1186449777 X:9662372-9662394 TGACTCAGCTTTGAAAAGGAAGG + Intronic
1186678174 X:11842589-11842611 AGTCTCAGGATACAAAATCAAGG - Intergenic
1186678477 X:11846180-11846202 AGTCTCAGGATACAAAATCAAGG + Intergenic
1188995270 X:36877318-36877340 ATATTCAGCCTTCAAAAGGAAGG + Intergenic
1189462095 X:41251072-41251094 TGACTCAGCAATGAAAAGGAAGG + Intergenic
1195115397 X:101693380-101693402 AGTCAGAGCTTCCAAAAGGAAGG - Intergenic
1195408910 X:104547696-104547718 AGTCTCAGGATACAAAATCAAGG - Intergenic
1195894302 X:109730345-109730367 AGGCTCAGCAATTGAAAGGATGG + Intronic
1196306231 X:114106506-114106528 AGTCTCTGCATTGAAAATAAGGG + Intergenic
1196613730 X:117743412-117743434 AGTCTCTGCATGGAAAAGGTGGG - Intergenic
1197029712 X:121798979-121799001 AGTCTCAGGATACAAAATCAAGG - Intergenic
1198745470 X:139885705-139885727 AGTGTCAGCAGTCAAAAACAAGG + Intronic
1198801022 X:140447841-140447863 ATTCCCAGCATCCAAAAGTAAGG + Intergenic
1199020840 X:142875935-142875957 TGTCTCAGCACTCAAAAAGTTGG + Intergenic
1199498445 X:148481789-148481811 TTTCTAAGCATTGAAAAGGAAGG + Intergenic
1199634196 X:149800195-149800217 TTATTCAGCATTCAAAAGGAAGG - Intergenic
1199713731 X:150491190-150491212 AGTTTCCTCATGCAAAAGGAGGG - Intronic