ID: 958664866

View in Genome Browser
Species Human (GRCh38)
Location 3:97124266-97124288
Sequence GATTAATACTGAAACGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958664866_958664870 7 Left 958664866 3:97124266-97124288 CCAGATGCGTTTCAGTATTAATC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 958664870 3:97124296-97124318 CACCGAGAGGAAACTTAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 98
958664866_958664868 3 Left 958664866 3:97124266-97124288 CCAGATGCGTTTCAGTATTAATC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 958664868 3:97124292-97124314 TCATCACCGAGAGGAAACTTAGG 0: 1
1: 0
2: 1
3: 6
4: 108
958664866_958664867 -6 Left 958664866 3:97124266-97124288 CCAGATGCGTTTCAGTATTAATC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 958664867 3:97124283-97124305 TTAATCTGATCATCACCGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 54
958664866_958664869 4 Left 958664866 3:97124266-97124288 CCAGATGCGTTTCAGTATTAATC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 958664869 3:97124293-97124315 CATCACCGAGAGGAAACTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958664866 Original CRISPR GATTAATACTGAAACGCATC TGG (reversed) Intronic
909882259 1:80894437-80894459 GATCAATACTGAAAAAAATCAGG - Intergenic
920380109 1:205530244-205530266 GATTCATACTGAAAGGCACAGGG - Exonic
922934998 1:229415685-229415707 GACTAATCCTGACACCCATCAGG + Intergenic
1070377565 10:75848657-75848679 GAGTAACACTGTAATGCATCTGG - Intronic
1074164801 10:110865704-110865726 AATAAATGCTGAAAAGCATCGGG + Intergenic
1078736446 11:14024919-14024941 GATTAGAACTGAAAAGAATCTGG + Intronic
1092660321 12:10731805-10731827 GATTCAAACTGAGACTCATCAGG + Intergenic
1093455610 12:19362231-19362253 GATTAATACGAAAACACATGTGG + Intronic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1095222758 12:39637009-39637031 GCTAATTACAGAAACGCATCAGG - Intronic
1101396386 12:104352096-104352118 GATTAACACTGATTCGAATCAGG + Intergenic
1101809265 12:108093576-108093598 GATTAATACTGGAAAGCAAGGGG - Intergenic
1104362154 12:128144105-128144127 GATTATTACTGAAAATCCTCAGG + Intergenic
1107563470 13:41578319-41578341 GAATAATCCTCAAACCCATCTGG - Intronic
1116801568 14:49449674-49449696 GATTTCTACTGAAATGGATCAGG + Intergenic
1118533610 14:66733121-66733143 GATTATTACTGAATAGCATGAGG - Intronic
1120787439 14:88550379-88550401 GGTTGAAACTGAAACGCACCCGG - Exonic
1121968551 14:98334702-98334724 GTTGAATTCTGAAACACATCTGG - Intergenic
1124582120 15:30966170-30966192 GATTAATACTGAAAATATTCAGG - Intronic
1126340600 15:47636812-47636834 GATTAATATTTACATGCATCGGG - Intronic
1126571009 15:50150558-50150580 GAGTCATACTGAAACTCTTCTGG + Intronic
1140891138 16:79286088-79286110 GATCAATATTGATAGGCATCTGG + Intergenic
1142948605 17:3458524-3458546 GAATAATACTGCAATGAATCTGG - Intronic
1144491943 17:15720603-15720625 GACAAATACTGAAACGCAAAGGG - Exonic
1144908534 17:18658591-18658613 GACAAATACTGAAACGCAAAGGG + Exonic
1155895995 18:31327140-31327162 GATGAAAACTGAAACTCATAAGG + Intronic
1161006410 19:1939327-1939349 GATTAAAGCTGAAATGAATCAGG + Intergenic
1166616697 19:44255114-44255136 TATTAAGACTGAAACACATGGGG - Intronic
925605876 2:5659455-5659477 GATTAAAACTGAACCCCTTCAGG + Intergenic
929346981 2:40896275-40896297 CATTAATTGTGAAACGTATCTGG - Intergenic
1169670224 20:8091607-8091629 AATTAATACTGTAAAACATCTGG + Intergenic
949386909 3:3513125-3513147 GATAAATACTGATAGGCAGCAGG + Intergenic
949911557 3:8914306-8914328 CATTAAAACTGAAATGCATATGG + Intronic
952110459 3:30117887-30117909 GATGAATACTGAAAAGAATAAGG - Intergenic
958019031 3:87976003-87976025 GATTAATACTGACATTTATCGGG - Intergenic
958558204 3:95706465-95706487 GATTAATACTGAGAAACTTCAGG + Intergenic
958664866 3:97124266-97124288 GATTAATACTGAAACGCATCTGG - Intronic
962692925 3:137918823-137918845 GAATAAAACTGAAAAGCCTCAGG + Intergenic
963657982 3:148083838-148083860 GATTAATAGAGAAAAGCATTAGG - Intergenic
974549868 4:63357625-63357647 GATTAATTCTGAAAGTCAACTGG - Intergenic
980150706 4:129044198-129044220 AATTTATACTGAAATGCATTTGG + Intronic
989264308 5:39455424-39455446 GATTAATAGTTAAATTCATCAGG - Intronic
993396015 5:87389707-87389729 ATTTAATACTGAAAAACATCAGG + Intronic
994709285 5:103246664-103246686 TATTAATACTGAAAGCAATCTGG + Intergenic
996312912 5:122127072-122127094 GATGAATACAGAAAAGCAGCTGG + Intergenic
999792673 5:154956647-154956669 GATAGATACTAAAAGGCATCAGG + Intronic
1005250160 6:23936383-23936405 AATTAACACTGATACACATCAGG - Intergenic
1007018504 6:38494920-38494942 AATAAATACTGCAAGGCATCTGG + Intronic
1010369047 6:75086314-75086336 CATTATTACTGAAATGCATCAGG + Exonic
1013747261 6:113360137-113360159 GATTAATACTGAAACATGTATGG + Intergenic
1019960548 7:4455828-4455850 GCTGAATTCTGAAACACATCTGG - Intergenic
1020660900 7:10980840-10980862 TATGAATTCTGAAACACATCTGG + Intronic
1026649026 7:72198764-72198786 GATCAATACTGAAAGGCAGATGG + Intronic
1028634180 7:92968689-92968711 GAGTAAGACTGAAACATATCAGG + Intergenic
1029671916 7:102039084-102039106 GATTAATAAAGAAAAGCATATGG + Intronic
1039114427 8:34076309-34076331 CATTAAGACTGAAATGCATCTGG - Intergenic
1041199544 8:55438021-55438043 GATTAAAACTGAAAAGGTTCTGG + Intronic
1045130101 8:99141579-99141601 GATTAATACTGACTCACATTAGG - Intronic
1046347742 8:112957275-112957297 GCTTATTACTGAAATGCATCAGG - Intronic
1051501164 9:17779250-17779272 GAGTAATTCTGATATGCATCAGG + Intronic
1052087291 9:24283568-24283590 TATCAACACTGAAACGTATCAGG - Intergenic
1052555597 9:30011844-30011866 GTTTAATACTAAAACACATTAGG - Intergenic
1059529486 9:115022926-115022948 GACTAATATTGAAAAGCAACAGG + Intronic
1188077077 X:25791195-25791217 AATTAGTACTGAAATCCATCTGG - Intergenic