ID: 958667065

View in Genome Browser
Species Human (GRCh38)
Location 3:97154624-97154646
Sequence ATGTTTTTAAAGGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958667065 Original CRISPR ATGTTTTTAAAGGTGGAGGA AGG (reversed) Intronic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
903604930 1:24568488-24568510 ATCTTCCTAGAGGTGGAGGAGGG + Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
904401456 1:30259364-30259386 TATTTTTTAAAGGTGGAGGAGGG + Intergenic
904719447 1:32496856-32496878 ATTTTTTTAAATGTTGAGGCTGG + Intronic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
906027820 1:42689591-42689613 ATGTTTTAAAAGGAGTGGGAGGG + Intronic
907571379 1:55487319-55487341 ATGTTTCTATACCTGGAGGAAGG - Intergenic
907891258 1:58638664-58638686 ATATATTTAGTGGTGGAGGAGGG + Intergenic
908375801 1:63539277-63539299 ATTTTTTTAAAGCTGGGGGTAGG + Intronic
908626997 1:66056384-66056406 ATTGCTTTGAAGGTGGAGGAAGG + Intronic
909072848 1:71017275-71017297 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
909393666 1:75144485-75144507 ATGTTTTTAAAGGTGGTAAAGGG + Intronic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
909795299 1:79728012-79728034 ATGTTTTTATAAGTGAATGAAGG + Intergenic
909818461 1:80027557-80027579 AGGTTTTTAAAGGCACAGGATGG - Intergenic
909857782 1:80561105-80561127 ATTTCCTTAAAGGTGGGGGAAGG + Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
910477045 1:87618634-87618656 ATTTTTTTAAAGGTGGAGTTAGG + Intergenic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911252948 1:95599267-95599289 AGGTCTTTAAAAGTGGAGAAGGG + Intergenic
911717828 1:101155079-101155101 TTGTTTTTATATGTGGATGAGGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
912271811 1:108218453-108218475 TTGTTCTTCAAGGTGGAGCATGG - Intergenic
912952332 1:114128478-114128500 GGGTTTTTAAAGGTCTAGGAGGG - Intronic
913012917 1:114702201-114702223 ATTATTTCAAAGGTGAAGGACGG - Intergenic
913571373 1:120123472-120123494 ATCTTTTTTTAGGGGGAGGAGGG + Intergenic
914292184 1:146284449-146284471 ATCTTTTTTTAGGGGGAGGAGGG + Intergenic
914348511 1:146820083-146820105 CTGTCTTTGAATGTGGAGGAAGG - Intergenic
914553228 1:148735232-148735254 ATCTTTTTTTAGGGGGAGGAGGG + Intergenic
914816439 1:151066448-151066470 AAGTATTTTAAGGTGGAGAATGG + Intronic
916729213 1:167551641-167551663 ATGATTCTAATGGGGGAGGAGGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916817690 1:168369705-168369727 ATTTTTTTAAAGAAGGAGGGTGG - Intergenic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917136607 1:171794160-171794182 GTGCTTTTAAATGTGGAAGAAGG + Intronic
917189011 1:172393701-172393723 TGTTTTTTAAAGGGGGAGGATGG - Intronic
917525238 1:175782641-175782663 ATGATTTAAAAGGAAGAGGAAGG + Intergenic
917554217 1:176067378-176067400 GAGTTTTTATAGGTGCAGGATGG - Intronic
917632963 1:176907907-176907929 CTGTTGTTAAAAGTGCAGGAAGG - Intronic
918058668 1:181044283-181044305 ATGCTTATAAATGAGGAGGAAGG + Intronic
918571523 1:185998646-185998668 ATGTTTTTCTAGGTGGAAAAGGG - Intronic
918627987 1:186680527-186680549 ATTTTTTTAAGGGGAGAGGAGGG - Intergenic
919297409 1:195720722-195720744 ACATTTTTGAAGGTGGAGGCAGG + Intergenic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
921137246 1:212272814-212272836 ATTTGACTAAAGGTGGAGGAGGG - Intergenic
921271563 1:213474894-213474916 ATGTTGTTAAAGGGAGAGAATGG - Intergenic
921359389 1:214316548-214316570 AAAATTTTAAGGGTGGAGGAGGG - Intronic
921548036 1:216496416-216496438 ATGTTATCGAAGGTGGGGGAGGG + Intergenic
921988645 1:221340070-221340092 AGGTTGGTAAAGGTGGAGGAAGG + Intergenic
924094490 1:240537128-240537150 AAATTTTTAAAGGTAAAGGAAGG - Intronic
924323464 1:242872222-242872244 TTGTTTTTAAATGTGGAAGGTGG - Intergenic
924800426 1:247325933-247325955 ATGATTTTAAACTTGGAGAAGGG - Intronic
1063756097 10:9010450-9010472 CTGATTTCAAAGGTGGGGGATGG - Intergenic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1064620468 10:17211427-17211449 ATTTTTTTTAAGGGGGAGGATGG - Intergenic
1066266509 10:33780937-33780959 ATGTTTTTAAGGGGCGTGGATGG - Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067781487 10:49210739-49210761 ATGCTTTTGAAGGTGAAGGATGG - Intergenic
1068904206 10:62304854-62304876 TTATTTTTAAAGGTGCAAGAGGG - Intergenic
1069075738 10:64036889-64036911 CTGTTTTTAATGGTGGACCAGGG - Intergenic
1069502730 10:68968397-68968419 ATGCTTTCAGAGGTGGAGGCAGG - Intronic
1071540681 10:86480675-86480697 ATGTTTTTAAAGGAAAATGAAGG - Intronic
1071688750 10:87792609-87792631 ATTTTTTTAGAGGTGGGGGTGGG - Intronic
1071750180 10:88466572-88466594 TCGTTTTTAAAGGTGGAGGCGGG - Intronic
1072017259 10:91360412-91360434 GTGTATTTAATGGTGTAGGATGG - Intergenic
1072219112 10:93312804-93312826 ATGTGTTTGGAGTTGGAGGAAGG - Intronic
1072917157 10:99545071-99545093 ATGTGTTTAAAGGCTTAGGAAGG - Intergenic
1073156996 10:101354714-101354736 ATGGATTTAAGGGTGGAGGAGGG + Intronic
1073235529 10:102012132-102012154 TTCTTTTTAAAGGAGGAGGAAGG + Intronic
1073657362 10:105431134-105431156 ATGGTATTAAAGGTGGTGGGAGG - Intergenic
1074271755 10:111960887-111960909 ATGATTATAAAGGTGAAGTATGG - Intergenic
1074319738 10:112391075-112391097 ATTTTTTTAAAAATTGAGGAAGG + Intronic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1075068819 10:119307512-119307534 CTGGTTTTGAAGGTGGAGGAAGG + Intronic
1075358255 10:121803346-121803368 ATGTTTTAAAAGGAGGAGGGAGG + Intronic
1078940642 11:16001347-16001369 ATCTTTTAAAATGTGTAGGAAGG + Intronic
1079436344 11:20455960-20455982 AGGTTTATAAACTTGGAGGAAGG + Intronic
1079593933 11:22217768-22217790 ATCTTTTGGAGGGTGGAGGATGG + Intronic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079693053 11:23443786-23443808 GTGTTTTTAAAAGTGAAAGAAGG - Intergenic
1079884323 11:25966873-25966895 CTGTGTTTAAAGGTGGATGCAGG + Intergenic
1080736086 11:35015295-35015317 ATGTTTTTAAAGTCAGAGGCAGG + Intronic
1081085964 11:38801815-38801837 AGTATTCTAAAGGTGGAGGATGG + Intergenic
1081340920 11:41926529-41926551 ATGGCTTTTAAGGTGGTGGAAGG + Intergenic
1085938393 11:81178523-81178545 AGGTTTGGAATGGTGGAGGAAGG - Intergenic
1085942393 11:81220692-81220714 ATGTTATTACAGCTGGAGGTTGG + Intergenic
1086599299 11:88612790-88612812 ATATTTTTAAAAGTGGGCGAAGG - Intronic
1087101320 11:94367997-94368019 ATGGCTTTGAAGCTGGAGGAAGG + Intergenic
1088474095 11:110217249-110217271 CTGTTTTTACAGGTCGGGGATGG + Intronic
1088998725 11:115030186-115030208 ATTTTTTAAAAGGTGGAGGATGG + Intergenic
1090051047 11:123380011-123380033 ATTTTTTTAAAGCTGGAGAAAGG - Intergenic
1090513882 11:127404027-127404049 ATGTGTTTAGGGGTGGAGGGAGG - Intergenic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1091213792 11:133887081-133887103 ATGTTTTCATAGGTGTGGGAGGG - Intergenic
1092812797 12:12287379-12287401 ATATTGTTAAAGAGGGAGGAAGG - Intergenic
1093348993 12:18072865-18072887 TGGTTTTTATAGGTGCAGGATGG + Intergenic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1094585517 12:31774050-31774072 AGGTCTAGAAAGGTGGAGGAAGG + Intergenic
1096572118 12:52529506-52529528 ATGTCCTTAAATGTGGAAGAGGG + Intergenic
1097161774 12:57051294-57051316 ATATATTTGAAGGTGGAGGGGGG + Intergenic
1097238666 12:57558097-57558119 TTGTTTTTAAAGGTGCAGAATGG - Intronic
1097727130 12:63088078-63088100 CTTTTTTTAAAGGCAGAGGAGGG + Intergenic
1097962586 12:65546824-65546846 AAGTTTTTAAAGGTCCAGGTTGG + Intergenic
1098010998 12:66051789-66051811 ATGTTTTAAAATGTGGTGGAAGG - Intergenic
1098074230 12:66710195-66710217 GTGTTTTTAAAAGTAGAAGAGGG + Intronic
1098300278 12:69047326-69047348 ATTCTTGTAAAGATGGAGGATGG + Intergenic
1098345716 12:69501219-69501241 ATTCTTTTAAAGGGGGAGGGGGG - Intronic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099293327 12:80799534-80799556 ATGTAATTAAAAGTGGAAGAGGG + Intronic
1099670423 12:85684508-85684530 ATATATTTAATGGTGGAAGATGG - Intergenic
1100372659 12:93982752-93982774 ATCATTTTAAAGGTGGCAGATGG + Intergenic
1100631820 12:96397854-96397876 ATGTTTTAAGTGGTGGAGTAGGG + Intronic
1100874008 12:98943567-98943589 ATGGTCTTGAAGATGGAGGAAGG - Intronic
1101033080 12:100678904-100678926 ATGTTTCTAAAGATGAGGGAAGG - Intergenic
1101058880 12:100950121-100950143 ATGTTTTCAACTGTGAAGGAAGG - Intronic
1101288493 12:103341358-103341380 ATATTTTTAATTTTGGAGGAGGG - Intronic
1101385939 12:104257903-104257925 AAGTTTTCAAAGGTGAAGGCTGG + Intronic
1101649434 12:106661470-106661492 ATGTTGTTAATGGGGGAGGCTGG - Intronic
1102814208 12:115849886-115849908 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1102872632 12:116426001-116426023 ATGCTTTGAGAGGTGGAGGCAGG - Intergenic
1103638864 12:122332013-122332035 ATATTTTTAAAGGTTGGGCACGG + Intronic
1104371248 12:128225643-128225665 ATGTCCTTAAATGTGGAAGAAGG + Intergenic
1104390989 12:128390477-128390499 GGGTTCTTAGAGGTGGAGGAGGG - Intronic
1104889568 12:132133807-132133829 ATGTCTGGAAAGGTGAAGGAGGG + Intergenic
1105970288 13:25423205-25423227 ATTTTTTTAAAAATGAAGGAAGG - Intronic
1106716166 13:32390655-32390677 ATGCTTCAAAAGCTGGAGGAAGG - Intronic
1106732871 13:32560206-32560228 AGTTTTTTTAAGGTGGAGGCTGG + Intergenic
1107686418 13:42904702-42904724 ATGTTTTGTAAGGTAGAGCAGGG + Intronic
1107697655 13:43016157-43016179 ATATTTAAAAAGGTGGAGAAAGG + Intergenic
1107895906 13:44963072-44963094 TTGTTTTTTTTGGTGGAGGAGGG - Intronic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108081117 13:46737246-46737268 ATTTTTTTAAATGTCGTGGAGGG - Intronic
1108248578 13:48542265-48542287 ATGTTTTTATAGGCACAGGATGG - Intergenic
1108618704 13:52160109-52160131 AGCTATTTGAAGGTGGAGGAAGG + Intergenic
1108852517 13:54750664-54750686 ATGTTTTTAATCCTGGAGGTTGG - Intergenic
1109112854 13:58345098-58345120 ATGTTTTTAAATGTGAAATAAGG - Intergenic
1110442311 13:75539034-75539056 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1110597784 13:77338100-77338122 CTGGCTTTAAAGGTGGAGGAAGG + Intergenic
1111107294 13:83663598-83663620 GGGTTTTTAAAAGTGGAAGATGG - Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1111528244 13:89501744-89501766 ATGATTTTAAAGCTGTAGGCAGG - Intergenic
1112429815 13:99341546-99341568 GTGTATTTAAAGCTGGAGGATGG + Intronic
1112781677 13:102907406-102907428 AGGTTTTAAATGGTAGAGGAGGG + Intergenic
1113096284 13:106667219-106667241 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1113322715 13:109251609-109251631 AAATTTTAAAAGGTGGGGGATGG + Intergenic
1113332360 13:109342109-109342131 CTGGTTTTAAAGGTGGAGGGAGG + Intergenic
1113859981 13:113475638-113475660 GTGCTTTGAGAGGTGGAGGAGGG + Intronic
1115100087 14:29688217-29688239 AGGTTCTTAAATGTGGAGGCAGG - Intronic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116648740 14:47563496-47563518 ATTTTTTTAAAGGTGAAGAAGGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1118635224 14:67742738-67742760 ATGTTTTCAAATGAGGAGGTGGG + Intronic
1118705396 14:68475677-68475699 TTTTTTTTAAAAGTGGAGGTAGG - Intronic
1118790533 14:69087762-69087784 TTATTTTAAAAGATGGAGGAAGG + Intronic
1119478303 14:74944411-74944433 ATTTTCTTAAAAGTGGATGATGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119811497 14:77524370-77524392 TTTTTTTTAAAGGTGGTGGCTGG - Intronic
1119962555 14:78876241-78876263 ATGTTTTCAAAGGCAGAGAAGGG + Intronic
1121298196 14:92847322-92847344 TTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1121567286 14:94919508-94919530 ATGTTTTTAAATGCAAAGGAGGG + Intergenic
1121786300 14:96663621-96663643 ATGTTATTAAGGGAGGAGGAAGG - Intergenic
1121864099 14:97346414-97346436 ATATTCTCCAAGGTGGAGGAGGG - Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1124061232 15:26295274-26295296 TTGTAATTAAAGGAGGAGGAGGG - Intergenic
1125606102 15:40940878-40940900 ATGTTGTTAAAGGTGGAGCCTGG - Intergenic
1125959701 15:43819311-43819333 ATTTTTTAAAAGGTAGAGAAAGG + Intronic
1126158780 15:45589224-45589246 ATGTTTTAAAAGTTGCAGAATGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1126862205 15:52896369-52896391 AAGTTTTTAAATGTGGAGAGAGG + Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127397143 15:58552058-58552080 CTGTTTTTAAGGGAGGGGGAGGG + Intronic
1127822552 15:62672215-62672237 ATGTTTCTAAATGTTGATGAGGG - Intronic
1128668731 15:69558420-69558442 CTGTTTTTAAGGGTCAAGGAAGG - Intergenic
1128810665 15:70569587-70569609 CTGGGGTTAAAGGTGGAGGAAGG + Intergenic
1128934263 15:71731972-71731994 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1129083181 15:73060218-73060240 AAGTTTTTGAAGTTGGAGGTAGG + Intronic
1129964103 15:79718449-79718471 ATGTGGTTAATGGTGGAGCAAGG + Intergenic
1129986727 15:79925082-79925104 CTGTTATTAAGAGTGGAGGAGGG - Intergenic
1130406559 15:83608024-83608046 TTGTTTTGTAAGGTGGGGGAGGG + Intronic
1130642176 15:85687742-85687764 ATTTTTTAAAAGGTGGGGGTGGG + Intronic
1131025984 15:89141912-89141934 ATATTTTTAAAGGTAGAGGTTGG + Intronic
1131144895 15:90004192-90004214 ATGGTTTTTGAGTTGGAGGAAGG + Intronic
1132171093 15:99656255-99656277 ATGTTAGTAGATGTGGAGGATGG - Intronic
1133388235 16:5387949-5387971 TTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1133508340 16:6433757-6433779 GTGCTTTGAAGGGTGGAGGAAGG - Intronic
1133720403 16:8489332-8489354 ATTTTTGTAAGGCTGGAGGAAGG + Intergenic
1134186460 16:12088772-12088794 ATGTTTTTATTTGTAGAGGAAGG - Intronic
1135061054 16:19271826-19271848 ATGTGTTGAAAGGTGAAGGAAGG + Intergenic
1135585447 16:23667248-23667270 ATTTTTTAAAAGGAGGAGGGTGG - Exonic
1137641483 16:50034594-50034616 GTGTTTTTAAAAGTAGATGATGG + Intronic
1137918012 16:52454164-52454186 ATTTTGTTAAAGGGGGATGATGG - Intronic
1138096494 16:54215801-54215823 ATATTTTTCAAGCTGCAGGAGGG - Intergenic
1138251702 16:55506803-55506825 GTGTTTTTGAGGGTGGCGGAGGG - Intergenic
1138777074 16:59735843-59735865 ATGTTTTGGAAGGATGAGGAGGG + Intronic
1139665437 16:68451898-68451920 TTTTTTTTAAGGGTGGAGGTAGG + Intergenic
1140312162 16:73860141-73860163 AAGCTTTTGGAGGTGGAGGAGGG - Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140578751 16:76203445-76203467 CTAATTTTGAAGGTGGAGGAAGG - Intergenic
1141191073 16:81824975-81824997 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1141342898 16:83219589-83219611 ATGATATTAAAGGTGAAGGAAGG + Intronic
1141372551 16:83500991-83501013 ATGTTTTCAAAGGTGTATTAAGG + Intronic
1144001902 17:11063196-11063218 AGGTTTCTAAAAGTGGAAGAGGG - Intergenic
1144028329 17:11297978-11298000 AGGTTATTAGAGGTTGAGGATGG + Intronic
1144311222 17:14015977-14015999 ATGTTTTTAGAGTTGCAGGAAGG - Intergenic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146340160 17:32011797-32011819 ATGTTTTTAAAAGTGCACAAAGG - Intronic
1146945942 17:36873569-36873591 TTCTTTTTAAAGGTGGGGGTGGG - Intergenic
1147499440 17:40948677-40948699 ATGTCTTTAAAAGTGGAAGAGGG + Intergenic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1148295209 17:46495685-46495707 ATGTTTTTAAAAGTGCACAAAGG - Intergenic
1148567227 17:48640687-48640709 GTGTTTTTACAGGTGAAGGCTGG + Intergenic
1149215016 17:54344597-54344619 CTCCTTTTAAAGGTGTAGGAAGG - Intergenic
1150208813 17:63429999-63430021 TTGTTTTTAAAGCTGAAAGAGGG - Intergenic
1150326096 17:64259155-64259177 ATGTTTCTAATGGTGAAGCAGGG + Intronic
1150407395 17:64914254-64914276 ATGTTTTTAAAAGTGCACAAAGG + Intronic
1150786969 17:68170808-68170830 ATTTTTGTAGAGGTTGAGGAGGG + Intergenic
1150990659 17:70254521-70254543 TTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1151005805 17:70434811-70434833 AGCTCTTTGAAGGTGGAGGAAGG - Intergenic
1151312696 17:73303691-73303713 ATGTTTTTAAAACTAAAGGAAGG - Intronic
1151852531 17:76699444-76699466 ATGTTCTTAAAGCTGGATGAGGG - Intronic
1152050916 17:77976294-77976316 ATGTTTTATAAGGTGGGTGAGGG + Intergenic
1152539614 17:80968401-80968423 AGGTCCTTAAAAGTGGAGGAGGG - Intergenic
1153082421 18:1243261-1243283 CTGTCTTTGAAGGTGGAGGAAGG + Intergenic
1153343278 18:3999099-3999121 AAATATTTAAAGGTAGAGGAAGG - Intronic
1153519546 18:5938741-5938763 ATGCTAGGAAAGGTGGAGGAAGG + Intergenic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1154120746 18:11650418-11650440 ATATTTTGGAAGGTGGAGGCGGG + Intergenic
1155341028 18:24814299-24814321 CTGGCTTTGAAGGTGGAGGACGG - Intergenic
1155709191 18:28854833-28854855 ATTTTTTTAAAGGGGGAGGGTGG - Intergenic
1155794015 18:30010907-30010929 ATGGCTTTGAAGGGGGAGGAAGG + Intergenic
1156307009 18:35886665-35886687 CTGCTATTGAAGGTGGAGGAAGG - Intergenic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1156884041 18:42113407-42113429 ATATTTTTAAAAGTTGGGGAGGG - Intergenic
1157351980 18:46896406-46896428 ATGTTTTTGGATGTGGAGGGAGG - Intronic
1157476707 18:48028565-48028587 ATGTGTTTAGAGGTGGAGGGCGG + Exonic
1158110044 18:53930823-53930845 ATGGCTTTAAAGATAGAGGAAGG - Intergenic
1158427937 18:57355175-57355197 TTGTTTTTTTAGGTGGAAGAAGG + Intronic
1158709091 18:59820964-59820986 ATATTTTGAAAGTAGGAGGATGG + Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1161468378 19:4444525-4444547 ATGGCTGTGAAGGTGGAGGAAGG - Intronic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162356510 19:10188790-10188812 CTGACTTTAAAGGTAGAGGAAGG + Intronic
1163769366 19:19181355-19181377 ATGTTTTTAAAAGTGGGACAAGG + Intronic
1164836201 19:31356697-31356719 AGTCTTATAAAGGTGGAGGAGGG - Intergenic
1165169708 19:33883174-33883196 ATCTTTGTAAAGGTTTAGGAGGG - Intergenic
1165240600 19:34463765-34463787 ATGTCCTTATAGGAGGAGGAAGG - Intronic
1165796335 19:38522055-38522077 ATGATTTTTCAGGAGGAGGAAGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1168519598 19:57038070-57038092 GTGTTTTTAAAAGAGGAGAAGGG + Intergenic
926071835 2:9901195-9901217 ATTTTTTTAAAGGTGGCTAAAGG - Intronic
926713064 2:15898642-15898664 ATATTTTTAAAGGTCGGGCATGG + Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
928052858 2:28018825-28018847 ATGTTTTAAAAAGTGGACTAAGG - Intronic
928340613 2:30440077-30440099 CTGACTTCAAAGGTGGAGGAAGG + Intergenic
928625626 2:33136921-33136943 ATTTTTTGAAAAGTAGAGGATGG + Intronic
928632659 2:33209774-33209796 AGGTTTTTAAAGGAGGAGCCTGG + Intronic
928759292 2:34562417-34562439 ATTTTTTTTAATGTGGATGATGG - Intergenic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
929827900 2:45324013-45324035 ATGACTTTGAAGATGGAGGAGGG - Intergenic
930231907 2:48851858-48851880 GGGTCTTTAAAGGTGGAAGAGGG - Intergenic
930938212 2:56982049-56982071 ATATTTTTAAGGGTGGAGTGAGG + Intergenic
930967309 2:57345382-57345404 ATGTTTTAAAAAGTGGAGTTGGG - Intergenic
930973793 2:57429753-57429775 ATGTTTCTTAATGTGGAGAAAGG + Intergenic
931056068 2:58472830-58472852 TGGTTTTTAAAAGTAGAGGAAGG - Intergenic
932011183 2:67978775-67978797 ATGTTTTTAAAGGGCAAGTATGG - Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932562298 2:72883987-72884009 ATGTCTTTAGAGGTTGGGGAGGG - Intergenic
932842025 2:75092262-75092284 AGGTTTTTAAAATTGGGGGAGGG - Intronic
933000786 2:76919877-76919899 ATCTGTTTAAAGTTGGAGAAAGG - Intronic
933120620 2:78532586-78532608 ATCATTGTAATGGTGGAGGAAGG - Intergenic
934880503 2:97972740-97972762 ATGTCCTTAAAAGTGGAAGAGGG + Intronic
935078817 2:99772084-99772106 TTGTTTTCTGAGGTGGAGGATGG - Intronic
935215182 2:100970280-100970302 AGGATTTGAGAGGTGGAGGATGG - Intronic
936530474 2:113272980-113273002 ATGTTTTAAAAAGTGGGGGCAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936582279 2:113711883-113711905 ATGTTTTTAAAGAAGGATAAAGG - Intronic
936727669 2:115341215-115341237 ATGTTTCAAAAGGCAGAGGAAGG - Intronic
936889817 2:117356143-117356165 GAGTTTGGAAAGGTGGAGGAAGG - Intergenic
937001417 2:118471268-118471290 ATTTTTTTAAAGGTAGAGCAAGG - Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938595186 2:132781879-132781901 ACTCTTTTAAAGGTGGTGGAGGG + Intronic
938622572 2:133071771-133071793 ATGCTTTGAAAGGGAGAGGAAGG + Intronic
939382216 2:141450055-141450077 ATTATTTTAAACGTTGAGGAGGG + Intronic
939790276 2:146564366-146564388 TTGGTTTTAAATGTGAAGGAAGG - Intergenic
940083029 2:149826260-149826282 ATGTTTCTACAGGAGGATGAGGG + Intergenic
940173658 2:150854988-150855010 AAGTTTTTGGAGGTGGGGGAGGG - Intergenic
940341693 2:152588265-152588287 TTGGCTTTAAAGCTGGAGGAAGG - Intronic
940486281 2:154299796-154299818 CTGTCTTTTAAGGGGGAGGAAGG + Intronic
940754633 2:157668117-157668139 ATGTTTTAAAATTTAGAGGAGGG - Intergenic
940975400 2:159937974-159937996 TTCTTTTTAAAGGTAGAGAAAGG + Exonic
941140930 2:161780994-161781016 ATGTTTTTTAAGGTTGGGGGAGG - Intronic
941158161 2:162003519-162003541 ATATTTTAAAAAGTGGAGGCTGG - Intronic
941186235 2:162324578-162324600 AGGTTTTTATAGGTACAGGATGG + Intronic
941220166 2:162768615-162768637 ATTTTTTTAAAGGAGGATGAAGG + Intronic
941359224 2:164531440-164531462 ATTTTCTTAGAGGTAGAGGAAGG - Intronic
941463735 2:165800832-165800854 ATTTTTTTAAAGGTGGACAGGGG + Intergenic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
942538062 2:176986340-176986362 ATGTTTTTAAAAAGGGAGGCGGG + Intergenic
943266921 2:185743207-185743229 ATGCTTTTAAATGTGGATCATGG - Exonic
944141703 2:196463959-196463981 GAGTTTTCATAGGTGGAGGAAGG - Intronic
944208578 2:197183396-197183418 ATGTATTTAAATGTCAAGGAAGG - Intronic
944230662 2:197388905-197388927 AATTTTTTAAAAGGGGAGGAAGG + Intergenic
944400778 2:199323730-199323752 GTATTTTTATTGGTGGAGGAAGG + Intronic
944576364 2:201094872-201094894 ATCTACTTGAAGGTGGAGGATGG + Intergenic
944901600 2:204222123-204222145 ATGTTGTTAAAGGTGGGGGGTGG - Intergenic
944943256 2:204653110-204653132 ATCTTCTTGAAGGTGGAGGTTGG + Intronic
945078281 2:206062667-206062689 ACATTTATATAGGTGGAGGAAGG + Intronic
945148481 2:206763556-206763578 AGGTTTTTAGAAGGGGAGGAGGG - Intronic
945918079 2:215725817-215725839 CTGGTTTTGAAGTTGGAGGAAGG - Intergenic
946530045 2:220560844-220560866 AGGATTTCAAAGGTGTAGGAAGG - Intergenic
947564418 2:231185129-231185151 ATGTTATTAAAGGGGGAGTCTGG + Intergenic
1169407807 20:5337963-5337985 AAGTTTTTAAAGGCAGAAGAAGG + Intergenic
1170031369 20:11947699-11947721 ATTTTTAAAAAGGGGGAGGAGGG - Intergenic
1170045889 20:12085027-12085049 AGGTCTTTAAATGTGGAAGAGGG - Intergenic
1170974196 20:21146720-21146742 TTGTTTTTATAGTAGGAGGAAGG + Intronic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173676829 20:44843366-44843388 AGGTCTTTAAAAGTGGAAGAGGG - Intergenic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174505252 20:51013508-51013530 ATGTTTTAATAGGTGCTGGAAGG + Intronic
1174807308 20:53615865-53615887 TTTTTTTTAAAGCTGCAGGAAGG - Intergenic
1174929006 20:54793395-54793417 ATATTTTTAATGTTGGAGGTGGG + Intergenic
1175692134 20:61073178-61073200 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1176427398 21:6557261-6557283 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1177429388 21:20971168-20971190 ATGTTTTTTAAAATGGGGGAGGG + Intergenic
1179008542 21:37535060-37535082 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1179240079 21:39582122-39582144 GGGTTTTTAAAAGTGGAGGAGGG + Intronic
1179364351 21:40742361-40742383 ATTTGTTTAAAGATGGAGAAAGG + Intronic
1179463805 21:41557327-41557349 CTGTTTTAAAAGGTGTAGAATGG + Intergenic
1179702889 21:43165578-43165600 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1179914955 21:44470673-44470695 ATGTTTTTAATTGTGTAGTATGG + Intergenic
1181643635 22:24218488-24218510 ATGCTTTTGAAAGTGGCGGATGG + Intergenic
1181685885 22:24527787-24527809 TTTTTTTTAAAGGTGCAAGAAGG - Intronic
1181845488 22:25705210-25705232 AACTTTTGAGAGGTGGAGGAAGG - Intronic
1183013682 22:34968633-34968655 GTGTTTGTAAAGGTGTAGTAGGG - Intergenic
1183209834 22:36444074-36444096 AAGGTTTCAAAGATGGAGGATGG + Intergenic
1184742115 22:46434579-46434601 ATGTGTGTGATGGTGGAGGATGG - Intronic
1184923606 22:47622749-47622771 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1185113611 22:48918753-48918775 ATGTTGCTCATGGTGGAGGATGG - Intergenic
949807704 3:7973882-7973904 ATTTATTTAAGGGAGGAGGAAGG + Intergenic
949828349 3:8186295-8186317 GTGTTTTTAAAGGCACAGGATGG + Intergenic
950206626 3:11085777-11085799 TTTTTTTTAAAGCTGGAGGGTGG - Intergenic
950492776 3:13316338-13316360 ATTTTTCTAAAGCTGGAGAAAGG - Exonic
951983312 3:28589579-28589601 ATCTTTTTAAGATTGGAGGAAGG + Intergenic
952318516 3:32253895-32253917 ATTTTTTTCAGGGGGGAGGATGG + Intronic
952458169 3:33494193-33494215 ATATTTTTAAAGGAGAAGGGAGG + Intergenic
952747761 3:36797463-36797485 ATATTTTTAAATGTTGATGATGG - Intergenic
953475332 3:43201190-43201212 AAGTTTTTAAAGAATGAGGAAGG - Intergenic
954661262 3:52228127-52228149 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
954809819 3:53241013-53241035 AGGTGTTGAAAGGCGGAGGAGGG - Intronic
955205835 3:56895124-56895146 CTGTCTTTGAAAGTGGAGGAGGG - Intronic
955888384 3:63624498-63624520 ATGTCCTTAAAAGTGGAAGAGGG - Intergenic
955926599 3:64012290-64012312 GTGTTTTTAAATGTTGATGATGG - Intronic
956004260 3:64762066-64762088 ATATTTTGAGAGGTGGAGGAGGG - Intergenic
956021322 3:64936383-64936405 ATATTTTAAAAAGTGGGGGATGG - Intergenic
956346079 3:68280569-68280591 ATTTCTTTAAAAGTGGAGGTAGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957197812 3:77093067-77093089 ATGTTTTTAAAAGAAGAGGAGGG - Intronic
957244230 3:77697596-77697618 ATAATTATAAAGGTGTAGGAAGG - Intergenic
957298787 3:78364300-78364322 CTTTTTTTTAAGGTGGAGAAAGG - Intergenic
957430783 3:80103447-80103469 ATGTTTTTAAAGGAGAAGGTAGG - Intergenic
957822007 3:85388770-85388792 TTTTTTTTAATGGTGGAGGTGGG - Intronic
958009922 3:87864073-87864095 GGGTCTTTAAATGTGGAGGATGG - Intergenic
958040051 3:88216499-88216521 ATGTCATTAAATGTTGAGGAGGG + Intergenic
958100186 3:88999164-88999186 AGGGTTTTAAGGGTAGAGGATGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959747231 3:109790931-109790953 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
959960956 3:112297052-112297074 ATTTTTTAAAAGGTGGGGGATGG - Intergenic
960626258 3:119685139-119685161 AAGTTTTTATAGGTTGAGGATGG - Intergenic
960943894 3:122952990-122953012 CTGTTTACAAAGGTGTAGGAAGG - Intronic
961846117 3:129765046-129765068 ATGCTTTGGGAGGTGGAGGAGGG - Intronic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
962842543 3:139249003-139249025 ATGTGTTGCAAGGAGGAGGATGG - Intronic
963617467 3:147559824-147559846 CTGGATTTGAAGGTGGAGGAAGG - Intergenic
963646462 3:147920767-147920789 ATGTTTTTAAAGTTATAGAAAGG - Intergenic
963665556 3:148181103-148181125 GGGTTTTTAAAAGTGGAAGAGGG - Intergenic
963920894 3:150903901-150903923 ATTTTTTTAAAGGTAGACGGTGG - Intronic
963967438 3:151388368-151388390 AAATTATTAAAAGTGGAGGACGG - Intronic
964668442 3:159199335-159199357 TTGTCTTTAAAGTTGGAGGAAGG + Intronic
964931417 3:162029565-162029587 AAGCTGTTAAAGGGGGAGGAAGG + Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965695373 3:171402646-171402668 GTTTTTTTGAAGCTGGAGGAAGG - Intronic
965702415 3:171471481-171471503 ATGATTTTTAAGGTGGATGCTGG + Intergenic
965717081 3:171616642-171616664 CTGACTTTAAAGGTGGAAGAAGG + Intronic
966375825 3:179294457-179294479 ATGTTTTAAAAGGTAGAGCTGGG + Intergenic
966671270 3:182529172-182529194 AACTTTTTAAGGGTGAAGGAGGG - Intergenic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967570534 3:191022864-191022886 ATGTTTTTATAGGTTAAAGATGG + Intergenic
968976078 4:3822692-3822714 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
969342722 4:6552435-6552457 ATGGTTTTGAAGATGGAGGGAGG - Intronic
969489737 4:7492183-7492205 ATGTATTTACAGGTGGCGGGAGG - Intronic
969989803 4:11250580-11250602 AAGTTTTTCAAAGTGGAGCATGG - Intergenic
970324591 4:14910357-14910379 TAGTTTTTAAAGGGAGAGGAAGG - Intergenic
970764415 4:19530440-19530462 CTGGCTTTCAAGGTGGAGGAAGG - Intergenic
971390401 4:26180164-26180186 ATCTTTTTGAGGGTGGAGGGCGG + Intronic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972297031 4:37749304-37749326 ATGCTTTGAAAGGCTGAGGAAGG + Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972910273 4:43807579-43807601 ATGTTTTTAGAGGTAGAGTCAGG - Intergenic
973833081 4:54781362-54781384 AAGTATTTAAATGTGGAGGTGGG - Intergenic
974272079 4:59662902-59662924 ATGTTTTCACAGGTGGGAGAAGG + Intergenic
974454773 4:62114301-62114323 ATTTTTTTAAGGGTGGGGGGTGG + Intergenic
974776504 4:66490004-66490026 ATGTTTTTATAGTTGGGGAAGGG + Intergenic
974970903 4:68825489-68825511 ATGTATTGGAAGGTGGAGGATGG - Intronic
974984884 4:69010903-69010925 ATGTGTTGGAGGGTGGAGGATGG + Intronic
976010580 4:80483108-80483130 AGGTTCTTAAAGGTGGAGGAGGG + Intronic
976018055 4:80584126-80584148 AGGTTTTAAAAGGGTGAGGATGG + Intronic
976250958 4:83051491-83051513 ATGTTTTTTAAGGTAGAGTAAGG + Intronic
976825599 4:89257012-89257034 ATGTTTTTAAAGAAAGAAGAAGG - Intronic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
977580434 4:98718776-98718798 ATGTTTTTAAAAGAATAGGAAGG + Intergenic
977676659 4:99755619-99755641 ATGTTTTTTGTGGGGGAGGAGGG + Intergenic
977714872 4:100171038-100171060 ATCTTTTTGGTGGTGGAGGAGGG + Intergenic
979835404 4:125360734-125360756 ATGTCTTTAGGGGAGGAGGATGG + Intronic
980330880 4:131409385-131409407 ATGCTTTTAGATGTGGAAGATGG - Intergenic
980534060 4:134092241-134092263 GGGTTTTTATAGGTAGAGGATGG - Intergenic
980851743 4:138390594-138390616 CTGGTTTTGAAGCTGGAGGAAGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
981701365 4:147610533-147610555 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
981917617 4:150051912-150051934 ATATTTTTAAAAGTGGGGCAGGG - Intergenic
984271847 4:177557474-177557496 GAGTTTTTATAGGTGCAGGATGG - Intergenic
985077724 4:186233454-186233476 ATCATATTAAAAGTGGAGGAAGG + Intronic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985720568 5:1486513-1486535 ATGTGATGAAAGGTGGAGGGAGG + Intronic
986755763 5:10834609-10834631 ATGTTTTTTGGGGTGGTGGATGG + Intergenic
987442118 5:17968548-17968570 AGGTTCTTAAATGTGGAAGAGGG - Intergenic
987474159 5:18370149-18370171 AAGTTTTTAAAAATAGAGGATGG + Intergenic
988659517 5:33250135-33250157 ATATATTTAAGTGTGGAGGATGG + Intergenic
988797183 5:34662183-34662205 ATTTTTTTGGAGGGGGAGGAGGG + Intronic
988949102 5:36240626-36240648 CTGTTTTTAAAGTTGGTGGGGGG + Intronic
990749978 5:59003952-59003974 TTTTTTTTAAAGGAGGGGGAAGG - Intronic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991363338 5:65843439-65843461 ATTTTTCTAATGGTGGTGGAAGG + Intronic
991449322 5:66734939-66734961 ATATTCTTAAGGGTGGAGCATGG - Intronic
991505816 5:67322945-67322967 ATATTTTGAAATGAGGAGGAAGG - Intergenic
992204581 5:74418818-74418840 GTATTTTTACAGGTGGAGGTGGG - Intergenic
993057842 5:83002921-83002943 ATGTTTTATAAGGTGCAGCATGG - Intergenic
993308729 5:86301548-86301570 TTGTTCTTCAAGGTGGAGCATGG + Intergenic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993574120 5:89580413-89580435 ATTTTTGTAGAGGTGGAGGTGGG + Intergenic
993653729 5:90553112-90553134 ATTTTTTTAGAGGTTGAGAATGG + Intronic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
995826323 5:116303749-116303771 TTATTTGAAAAGGTGGAGGAAGG + Intronic
996092096 5:119361436-119361458 ATGGTTTTGAAGATGGGGGAGGG + Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
997202259 5:132018084-132018106 AGGCTTTTAGAGGTGGTGGAAGG + Intergenic
997261547 5:132469231-132469253 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
998863134 5:146465543-146465565 ATCTTTTTAATGATGGAGCAAGG - Intronic
999554271 5:152723162-152723184 AAGGTTTAGAAGGTGGAGGAAGG - Intergenic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1003436065 6:6089508-6089530 AAGTTCTTAAATGTGGAAGAGGG + Intergenic
1004449467 6:15731443-15731465 TTTTTTAAAAAGGTGGAGGAGGG + Intergenic
1005097224 6:22130619-22130641 ATGTTTTTATATTTGTAGGAGGG + Intergenic
1005289676 6:24366999-24367021 ATTTTTTTAAATGTTGTGGAGGG + Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1005917050 6:30361911-30361933 TTCATTTTGAAGGTGGAGGAAGG + Intergenic
1006003055 6:30981472-30981494 CTGTTGCTAAAGGTGGAGAATGG - Intergenic
1006244382 6:32717579-32717601 AGGTTTTTATAGGCAGAGGATGG + Intergenic
1006556957 6:34875325-34875347 ATGTTCTTGAAGGGGGAGGAAGG + Exonic
1007671013 6:43553870-43553892 AAGATTATAAAGGGGGAGGAGGG - Intronic
1008344008 6:50403922-50403944 TTATTTTTAAAGGTGGCAGAAGG + Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1010558293 6:77313714-77313736 ATGATTTGAAAGACGGAGGAAGG + Intergenic
1010705054 6:79098286-79098308 ATGTTTTTAAAGTTTAAGAATGG - Intergenic
1010959010 6:82124102-82124124 ATGTTTTGGAGGATGGAGGAAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011231452 6:85166043-85166065 TTGTTTTTAAACTTTGAGGAAGG - Intergenic
1012021348 6:93924918-93924940 ATAATTTTACAGGTAGAGGATGG - Intergenic
1012084355 6:94805158-94805180 GTGATTTTGAAGATGGAGGAAGG - Intergenic
1012144290 6:95662120-95662142 ACCTTTTTGAGGGTGGAGGATGG + Intergenic
1013007775 6:106090006-106090028 ATGATTTTAAAGGAGAATGACGG - Intronic
1013827681 6:114234031-114234053 ATGTTTTCCAAGTTGGAGAACGG + Intronic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014254987 6:119151943-119151965 ATGCTTTTAAAGTTTGAGGTAGG + Intergenic
1014309218 6:119779405-119779427 GCCTTCTTAAAGGTGGAGGATGG + Intergenic
1014717282 6:124880558-124880580 ATGTACTTGAAGGTAGAGGATGG + Intergenic
1015020638 6:128469783-128469805 GTGTCTTTAAATGTGGAAGAGGG + Intronic
1015212763 6:130716963-130716985 CTCTTTTTAAAGGGGGAGAAAGG - Intergenic
1015851893 6:137582736-137582758 AAGTTTTTAAGAGTGGAGAATGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1018062189 6:160098994-160099016 ATTTTTGTAAAGTAGGAGGAAGG - Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1019739827 7:2667112-2667134 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1020398290 7:7743733-7743755 ATTTTTTTAAAAGTGCAGAATGG - Intronic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1022212100 7:28221376-28221398 ACTTTTTTAAACGTGCAGGAGGG - Intergenic
1022243285 7:28533292-28533314 ATGTTTATAAAGGTTAAGGGAGG - Intronic
1022269301 7:28790567-28790589 ATCTTTTTCAAAGTAGAGGAGGG - Intronic
1023349563 7:39307160-39307182 ATGTTTTAAGAGGTGGTGGCTGG - Intronic
1023950333 7:44838979-44839001 ATTTTTTTAAAGGAGGAATAGGG + Intronic
1024479436 7:49848608-49848630 ATGATTTTACAAGTGGAGAAAGG - Intronic
1026282351 7:68933168-68933190 ATGACGTTCAAGGTGGAGGAGGG - Intergenic
1027634489 7:80653991-80654013 ATTTTTTTAGAGGTGGAAAATGG - Intronic
1028655265 7:93198026-93198048 ATGTGATTAAAGGTGCAAGAGGG + Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1028988118 7:97023666-97023688 AGCCATTTAAAGGTGGAGGAGGG - Intronic
1029003703 7:97184391-97184413 ATATTTTTAAAAGTGGGGGTAGG - Intergenic
1029485626 7:100838245-100838267 ATGCTTTGGAAGGTGGAGGCAGG - Intronic
1031502515 7:122537012-122537034 ACTTTTTTGAGGGTGGAGGATGG + Intronic
1031531595 7:122883688-122883710 ATTTTTTAAAAGGTGGGGGAGGG + Intronic
1031632505 7:124061699-124061721 ATGTCCTTAAAAGTGGAAGAGGG - Intergenic
1032464404 7:132134809-132134831 AGGGTTCTGAAGGTGGAGGAGGG - Intronic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1032904905 7:136353400-136353422 ATGCTTTTAAAAGTGCAGCAAGG + Intergenic
1033275349 7:139967451-139967473 ATGTCTTTATAGGCTGAGGATGG + Intronic
1033444849 7:141411440-141411462 TAATTTTTAAAGGGGGAGGAAGG + Intronic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1033949902 7:146772355-146772377 TTGTTTTTAAAGGAAGAGGAGGG + Intronic
1034926097 7:155123382-155123404 ATGTTTTTAAAAGAGGAGAAAGG - Intergenic
1034932819 7:155176298-155176320 ATGTGTTGTAAGGTGGGGGATGG - Intergenic
1035004133 7:155642999-155643021 ATTTTTTGAACTGTGGAGGATGG - Intronic
1036744687 8:11397880-11397902 ATGTTTTTAAACGTCAAGCAGGG + Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037250742 8:16891109-16891131 ATGTTTTTAAAGGGAGAGCTTGG + Intergenic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038227462 8:25670402-25670424 ATGGTTTCAAGGGTGGAGGTAGG + Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1038943721 8:32334029-32334051 AAGTTTTTAATTGTGCAGGAGGG - Intronic
1039232705 8:35465896-35465918 CTCATTTTGAAGGTGGAGGAAGG + Intronic
1039355311 8:36808994-36809016 AGGTTTTGAAAGTTGGAAGAGGG - Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039996581 8:42539904-42539926 GTGTTTTTCAAGTTGGAAGATGG - Intronic
1042164470 8:65932286-65932308 ATGTTTTTAAAAATGGGGGGAGG + Intergenic
1042460448 8:69059219-69059241 ATGCTCTTAATGTTGGAGGATGG - Intergenic
1042467310 8:69142020-69142042 CTGATTTCAAAGGCGGAGGAGGG - Intergenic
1043230432 8:77793588-77793610 ATCTTTTTCAAGGCAGAGGAGGG + Intergenic
1043348378 8:79327339-79327361 AAGTTTTTATAAGTGGAAGAGGG + Intergenic
1043554047 8:81409357-81409379 AAGTTCTTAAAGGTGGAACACGG + Intergenic
1043872447 8:85449124-85449146 TTGTTTTTATAGCTGAAGGATGG + Intergenic
1044338164 8:91014242-91014264 ATACTTTTAAAGGTGGAGGCTGG + Intronic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045439322 8:102193983-102194005 TTGTTTTAAAAGGGGGAGGCTGG + Intergenic
1045639240 8:104229324-104229346 ATGTTTTTGATTGGGGAGGAGGG + Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046250562 8:111624857-111624879 ATGTTTTTATAGGCCCAGGATGG + Intergenic
1046399230 8:113682213-113682235 ATTTTTTTAAAGGAGGAGGTGGG + Intergenic
1046577400 8:116047869-116047891 ATTTTTTTAAAAGTGAATGATGG + Intergenic
1046785818 8:118265383-118265405 ATTTTTTTACAAGTTGAGGATGG + Intronic
1047085676 8:121512857-121512879 ATGTTTTTAAAGTTGGTGGGAGG - Intergenic
1047533764 8:125700457-125700479 ATGTTTCTAGCTGTGGAGGAAGG + Intergenic
1048017567 8:130511283-130511305 ATTTGTTTAAGGGTGGGGGATGG + Intergenic
1048449113 8:134516532-134516554 TTGTTTTTAAAGGTAGAATAGGG + Intronic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1048734648 8:137485822-137485844 ATATTCTCAAAGGTAGAGGAGGG + Intergenic
1048893297 8:138966659-138966681 CAGTTTTTAAAGGGGGAGAAGGG + Intergenic
1049925466 9:402846-402868 ATGTTTTGAAAAGAGGAGTAAGG - Intronic
1049976321 9:863443-863465 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1050208678 9:3228067-3228089 TTCTTTTAAAAGGTGGCGGAGGG - Intronic
1050257466 9:3810195-3810217 TTGATTTTAAAAGTGGTGGAGGG + Intergenic
1050873619 9:10608385-10608407 GTGTTTTTGAAGGAGCAGGATGG - Intronic
1051925823 9:22323559-22323581 CTGCCTTTGAAGGTGGAGGAAGG - Intergenic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1052159847 9:25244183-25244205 AATTATTTAAATGTGGAGGATGG + Intergenic
1052957525 9:34265053-34265075 ATGATTTTACAAGGGGAGGAAGG + Intronic
1053594797 9:39548890-39548912 AAGTTCTTAAAAGTGGAAGAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054341933 9:63873878-63873900 ATGGTATTAGAAGTGGAGGAGGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054571456 9:66816077-66816099 AAGTTCTTAAAAGTGGAAGAGGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054874220 9:70078483-70078505 AAGTTTTTAAAGGTGAAGAAAGG + Intronic
1056243847 9:84674605-84674627 ATGTATTTAAATTTGGAGCACGG + Intronic
1057907959 9:98996976-98996998 ATGTCTTCAAAGGGGGAGGATGG - Exonic
1058286389 9:103185010-103185032 ATGGTTTTGAAGATGGAGAAAGG + Intergenic
1058362116 9:104160339-104160361 ATATGTTTAAAGGTGGAATATGG - Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059042653 9:110830823-110830845 ATGTTTTTATAGGCCCAGGATGG + Intergenic
1059313278 9:113403008-113403030 ATGTTTCAAAAGGTGGAGGCTGG - Intergenic
1059685608 9:116632792-116632814 ATGTTGTCAAAGGTGCAGTAAGG - Intronic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1060318825 9:122536293-122536315 CTGTTTTTAAAGGTGGATATTGG - Intergenic
1060647269 9:125291668-125291690 GGGTTTTTAATGGTGGAGGGAGG + Intronic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1061020031 9:128008377-128008399 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1061222369 9:129259626-129259648 AGGTTCTTAAATGTGGAAGAGGG - Intergenic
1061666041 9:132161605-132161627 GTCTTCTTAAAGGTGCAGGAAGG - Intergenic
1061819825 9:133220910-133220932 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1062240830 9:135537038-135537060 CTGGCTTTGAAGGTGGAGGAGGG - Intergenic
1203441139 Un_GL000219v1:9648-9670 ACACTTTGAAAGGTGGAGGATGG + Intergenic
1203511948 Un_KI270741v1:128556-128578 ACACTTTGAAAGGTGGAGGATGG + Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186724658 X:12344426-12344448 AGATTTTAAAAAGTGGAGGAGGG - Intronic
1187560353 X:20397211-20397233 TTTTTTTTAAAAGTGGAGAAGGG + Intergenic
1187592944 X:20739042-20739064 ATGATTTTAAACGAGGAGGAAGG - Intergenic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188062036 X:25612792-25612814 GTGTTTTGAACGGTGGAGTATGG + Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189232453 X:39463165-39463187 GTGTTTCTAAGGCTGGAGGACGG + Intergenic
1189876024 X:45436760-45436782 ATGCTCTGAAAGGTGGAAGAGGG - Intergenic
1190279716 X:48921758-48921780 AGGTTTTAGAAGGTGAAGGACGG - Intergenic
1190312631 X:49127860-49127882 ATGTATTTAAAGGTGAGGCACGG + Intergenic
1190409863 X:50125797-50125819 TTGTTTTTCAAGGGGGAGGATGG + Intergenic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1191725000 X:64270148-64270170 TTTTTTTTAAAGGTGGAGGGGGG - Intronic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1193260564 X:79402315-79402337 ATTTTTTGAAAGATTGAGGAGGG - Intergenic
1193320099 X:80111747-80111769 ATGTTTTTCGTGGTGGGGGAAGG + Intergenic
1193752842 X:85367739-85367761 ATATTTTTAAAGTTGGAGAATGG + Exonic
1195491146 X:105471380-105471402 ATGTTTTTGAAAGTTGAGAAAGG + Intronic
1196386229 X:115155260-115155282 ATTTTTCTAAAGGTGGGGAAGGG + Intronic
1196396372 X:115266622-115266644 ATGTTTCTAAAGATGTAGAATGG - Intergenic
1196502947 X:116406939-116406961 TTGTTTTCAAAAGTGGAAGAGGG - Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197148971 X:123198882-123198904 ATGTGTTTAAAGTGGGAGCATGG + Intronic
1197998462 X:132406335-132406357 GCGTTTTTAAGTGTGGAGGAGGG + Exonic
1198025173 X:132698483-132698505 ATGTTTTTAAAGGCAGTGAAAGG - Intronic
1198201037 X:134419021-134419043 TTGTTTTTTGAGGAGGAGGAAGG + Intronic
1199030793 X:142996814-142996836 ATGTCTATAAAGATAGAGGAGGG + Intergenic
1200051822 X:153436848-153436870 ATCTTTTTTTAGGGGGAGGAGGG - Intergenic
1201651525 Y:16294308-16294330 ATTTTTTCAAAGGTGGCTGAAGG + Intergenic
1202106260 Y:21370200-21370222 ATATTTTTAAAGATAGAGAAGGG + Intergenic