ID: 958670522

View in Genome Browser
Species Human (GRCh38)
Location 3:97197976-97197998
Sequence AGGGAGAGCACGGTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 25, 2: 67, 3: 140, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958670522_958670528 25 Left 958670522 3:97197976-97197998 CCTACAATCACCGTGCTCTCCCT 0: 1
1: 25
2: 67
3: 140
4: 311
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958670522 Original CRISPR AGGGAGAGCACGGTGATTGT AGG (reversed) Intronic