ID: 958670522 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:97197976-97197998 |
Sequence | AGGGAGAGCACGGTGATTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 544 | |||
Summary | {0: 1, 1: 25, 2: 67, 3: 140, 4: 311} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
958670522_958670528 | 25 | Left | 958670522 | 3:97197976-97197998 | CCTACAATCACCGTGCTCTCCCT | 0: 1 1: 25 2: 67 3: 140 4: 311 |
||
Right | 958670528 | 3:97198024-97198046 | AGCACCATGAGCCCCCTGCCAGG | 0: 1 1: 0 2: 0 3: 17 4: 257 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
958670522 | Original CRISPR | AGGGAGAGCACGGTGATTGT AGG (reversed) | Intronic | ||