ID: 958670528

View in Genome Browser
Species Human (GRCh38)
Location 3:97198024-97198046
Sequence AGCACCATGAGCCCCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958670526_958670528 0 Left 958670526 3:97198001-97198023 CCCAAACACACAGATTCTCTCTC 0: 4
1: 47
2: 175
3: 424
4: 967
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257
958670523_958670528 15 Left 958670523 3:97197986-97198008 CCGTGCTCTCCCTTTCCCAAACA 0: 1
1: 0
2: 3
3: 45
4: 554
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257
958670527_958670528 -1 Left 958670527 3:97198002-97198024 CCAAACACACAGATTCTCTCTCA 0: 1
1: 2
2: 55
3: 243
4: 857
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257
958670525_958670528 5 Left 958670525 3:97197996-97198018 CCTTTCCCAAACACACAGATTCT 0: 1
1: 2
2: 41
3: 153
4: 640
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257
958670524_958670528 6 Left 958670524 3:97197995-97198017 CCCTTTCCCAAACACACAGATTC 0: 1
1: 2
2: 37
3: 145
4: 621
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257
958670522_958670528 25 Left 958670522 3:97197976-97197998 CCTACAATCACCGTGCTCTCCCT 0: 1
1: 25
2: 67
3: 140
4: 311
Right 958670528 3:97198024-97198046 AGCACCATGAGCCCCCTGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958670528 Original CRISPR AGCACCATGAGCCCCCTGCC AGG Intronic