ID: 958673710

View in Genome Browser
Species Human (GRCh38)
Location 3:97238079-97238101
Sequence GCATGTACATAATTTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958673710_958673712 21 Left 958673710 3:97238079-97238101 CCAAGCTAAAATTATGTACATGC 0: 1
1: 0
2: 1
3: 13
4: 182
Right 958673712 3:97238123-97238145 GATGCAAATGCTTACTTTTCAGG 0: 1
1: 0
2: 1
3: 25
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958673710 Original CRISPR GCATGTACATAATTTTAGCT TGG (reversed) Intronic
904313277 1:29643047-29643069 GCAGCTGCCTAATTTTAGCTGGG + Intergenic
904350234 1:29900436-29900458 GCAGCTGCCTAATTTTAGCTGGG + Intergenic
904665621 1:32118857-32118879 GCCTGTAAAGCATTTTAGCTCGG + Intronic
904867557 1:33592786-33592808 GAATGTACAAAAAATTAGCTGGG + Intronic
909235584 1:73148862-73148884 GCACGTATATGTTTTTAGCTAGG - Intergenic
909622063 1:77680008-77680030 GTATCTACATAAGTTTAGCTTGG - Intronic
910616663 1:89205732-89205754 GCCTGTACCTCATTTTATCTTGG + Intergenic
911264682 1:95729359-95729381 AAATATACATAATATTAGCTAGG + Intergenic
911543993 1:99193823-99193845 CCTTGTACATAGCTTTAGCTTGG + Intergenic
913647019 1:120867234-120867256 GAATGTAAATAAATTTAGATTGG - Intergenic
914079623 1:144395631-144395653 GAATGTAAATAAATTTAGATTGG + Intergenic
914174523 1:145264172-145264194 GAATGTAAATAAATTTAGATTGG + Intergenic
914529251 1:148505657-148505679 GAATGTAAATAAATTTAGATTGG + Intergenic
917140909 1:171834671-171834693 TCATGAACATAATTTTAAATGGG + Intergenic
917174790 1:172221707-172221729 GCATGCACATAATTTTAAATAGG - Intronic
918640999 1:186841363-186841385 ACATATATATAATTTTAGTTTGG - Intronic
918697463 1:187561275-187561297 GCATGTGCATACTATTAGGTTGG - Intergenic
921414816 1:214873164-214873186 GCATTCACATAATTTTTGCCTGG - Intergenic
921525682 1:216214866-216214888 GTATGTGTATAATTTTAGTTAGG + Intronic
921769159 1:219014518-219014540 TCATACACATAATATTAGCTTGG - Intergenic
923118331 1:230965432-230965454 GCATATACACCATTTTAACTGGG - Intronic
924309274 1:242722938-242722960 GCTTGTACATTTTTTTAGCTAGG + Intergenic
1066143608 10:32533465-32533487 TCATGTACTTAATTTTACCAAGG + Intronic
1066551578 10:36564138-36564160 GGATGTACATATTTCTAGTTTGG - Intergenic
1071168300 10:82832702-82832724 TCAAATACATAATTTTATCTTGG - Intronic
1072327429 10:94312249-94312271 GCATGTACTTAATTTTTATTTGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073970380 10:109041082-109041104 GCATTTACAAACCTTTAGCTAGG - Intergenic
1076067387 10:127459575-127459597 GCATTTACAAACCTTTAGCTAGG + Intergenic
1079035528 11:17016134-17016156 GCATGCACATAATTTTGGGAGGG + Intergenic
1080381965 11:31781230-31781252 GCATGTATATACTTTTGGTTGGG - Intronic
1083029292 11:59577262-59577284 GAACGTAGATAATTTCAGCTGGG - Intronic
1085595686 11:77807316-77807338 GCAAGTACCTAATTTTGGCCAGG - Intronic
1085608501 11:77924513-77924535 GCAGGCACATAATATTTGCTAGG + Intronic
1092809149 12:12255998-12256020 GTATGTACCTTATTTTACCTGGG - Intronic
1095642491 12:44501156-44501178 GCATTTACAAACCTTTAGCTAGG - Intergenic
1095759873 12:45819182-45819204 ACATGTAAATAATTTAAGTTGGG + Intronic
1097485325 12:60190587-60190609 GCATTTACATATTTTCATCTGGG - Intergenic
1097491036 12:60270229-60270251 GCATTTACAAACCTTTAGCTAGG - Intergenic
1098680172 12:73344287-73344309 GGATATACAAAATTTTATCTAGG - Intergenic
1098943731 12:76566881-76566903 GCATGCACATAATTTTGAATAGG - Intergenic
1099203118 12:79698545-79698567 GCATGTCCATAGTCTTAACTAGG + Intergenic
1099731180 12:86505451-86505473 GTATGTATAGAATTTTAGGTGGG - Intronic
1101948089 12:109153536-109153558 GCATTTACATTATTTTTGGTTGG + Intronic
1102796102 12:115690041-115690063 GCAGGTACAAAATTTCAGTTTGG + Intergenic
1111498086 13:89079932-89079954 ACATGTACAAAATTTTGGATTGG + Intergenic
1111979122 13:94998562-94998584 CCATGCACATAATTTTTGTTAGG - Intergenic
1112903932 13:104394002-104394024 GCAGGGACATCATTTTAGTTTGG - Intergenic
1116698804 14:48210926-48210948 GCATGTACAAAATTTCTGTTCGG - Intergenic
1118704123 14:68464552-68464574 GAATGTACAGAATTCTAGCTTGG - Intronic
1202832753 14_GL000009v2_random:54534-54556 GCATATACATGATTTTAGAAAGG - Intergenic
1202845544 14_GL000009v2_random:169968-169990 GGATGTACCTAATTCGAGCTGGG - Intergenic
1202875247 14_GL000225v1_random:201252-201274 GGATGTACCTAATTCGAGCTGGG + Intergenic
1202877726 14_KI270722v1_random:22472-22494 GGATGTACCTAATTCGAGCTGGG + Intergenic
1124875730 15:33591402-33591424 CCATGTACAACATCTTAGCTTGG - Intronic
1125138399 15:36371691-36371713 GCATGTACATTCTTTTTGGTTGG - Intergenic
1125252917 15:37726791-37726813 GCATGTAGGTTATTTTAGCTGGG - Intergenic
1126191843 15:45886221-45886243 GCATTTACAAACCTTTAGCTAGG - Intergenic
1127006657 15:54578256-54578278 AAATGTACATATTTTTAGCTCGG + Intronic
1145025825 17:19467173-19467195 GCCTGTACATAGTTTAAGATGGG - Intergenic
1148373410 17:47119267-47119289 ACATATACATAAATTTAGGTAGG + Intronic
1148522060 17:48286801-48286823 TCATCTAGATAATTTTCGCTGGG + Intronic
1154422645 18:14247944-14247966 GCATATACATGATTTTAGAAAGG - Intergenic
1157000451 18:43516840-43516862 GCATGTACATATTTTATGTTAGG + Intergenic
1161926816 19:7306953-7306975 GCATGTAGAAACTTTCAGCTGGG + Intergenic
1161926876 19:7307379-7307401 GCATGTAGAAACTTTCAGCTGGG + Intergenic
1202639929 1_KI270706v1_random:73192-73214 GCATATACATGATTTTAGAAAGG + Intergenic
1202672952 1_KI270710v1_random:10468-10490 GGATGTACCTAATTCGAGCTGGG - Intergenic
927417754 2:22896583-22896605 GGATAAACATAATTTAAGCTAGG - Intergenic
927644951 2:24871816-24871838 GCTTGTACATAGTTTTGGCCTGG - Intronic
929187429 2:39109770-39109792 GCATGTACACAATATTGCCTAGG + Intronic
930656241 2:54009812-54009834 TCATGTACTTAATTTGTGCTAGG + Intronic
934495417 2:94792611-94792633 GCATATACATGATTTTAGAAAGG + Intergenic
938503843 2:131853982-131854004 ACATCTGCATTATTTTAGCTTGG - Intergenic
939123477 2:138146969-138146991 GCACGTACATAATTTTAGAAAGG + Intergenic
940504515 2:154535843-154535865 GCTTGTACTTAATTCTGGCTTGG - Intergenic
940623677 2:156146239-156146261 GCATGTAAATAATCTCAGTTTGG - Intergenic
942662253 2:178278222-178278244 GCATGAAAATAATTCTAGCTTGG - Intronic
944007613 2:194929727-194929749 GCATGTACAAAAATTTTGATTGG - Intergenic
947511721 2:230761090-230761112 GCATGTACATAATGAGATCTTGG + Intronic
948402781 2:237695828-237695850 GAATTTACTTAATTTTATCTAGG - Intronic
1173438593 20:43055315-43055337 GGAAGCACATAAGTTTAGCTTGG + Intronic
1174053530 20:47783723-47783745 TTATGTATATAAATTTAGCTGGG + Intronic
1176639014 21:9279912-9279934 GGATGTACCTAATTCGAGCTGGG + Intergenic
1176648260 21:9370789-9370811 GCATATACATGATTTTAGAAAGG + Intergenic
1176850819 21:13912016-13912038 GCATATACATGATTTTAGAAAGG + Intergenic
1177717604 21:24859572-24859594 GCATGTATATATTTTTTTCTGGG + Intergenic
1177992585 21:28056167-28056189 ACATCTGCATTATTTTAGCTTGG + Intergenic
1180362009 22:11908678-11908700 GCATATACATGATTTTAGAAAGG - Intergenic
1180372322 22:12052754-12052776 GGATGTACCTAATTCGAGCTGGG + Intergenic
1180376148 22:12095900-12095922 GCTTTTACATAATATTAGGTGGG + Intergenic
1180390153 22:12222899-12222921 GGATGTACCTAATTCGAGCTGGG - Intergenic
1180415781 22:12711568-12711590 GGATGTACCTAATTCGAGCTGGG + Intergenic
1180423059 22:12887419-12887441 GGATGTACCTAATTCGAGCTGGG + Intergenic
950270190 3:11608293-11608315 ACATGAAGATAATTTTATCTAGG + Intronic
950685452 3:14615071-14615093 GCATGTTCATATTTCTATCTGGG - Intergenic
950777367 3:15362248-15362270 ACATCTACAAAATTTTAGATAGG + Intergenic
952921521 3:38288059-38288081 GTAGGTACAGAATTTCAGCTTGG - Intronic
956261073 3:67342252-67342274 ACAAGTACATAATTTTAACATGG + Intergenic
957177956 3:76837071-76837093 ACATGTAGATAATATTAACTTGG - Intronic
957510589 3:81182731-81182753 GCATTTACAAACCTTTAGCTAGG + Intergenic
958062402 3:88500120-88500142 ACATGTACAAAATTATAGTTTGG - Intergenic
958673710 3:97238079-97238101 GCATGTACATAATTTTAGCTTGG - Intronic
963403098 3:144826562-144826584 GCATTTACAAACCTTTAGCTAGG + Intergenic
966506804 3:180712776-180712798 GCATGTGTATGATTTTAGCAAGG + Intronic
1202738626 3_GL000221v1_random:34196-34218 GCATATACATGATTTTAGAAAGG - Intergenic
1202747881 3_GL000221v1_random:125107-125129 GGATGTACCTAATTCGAGCTGGG - Intergenic
969402626 4:6966494-6966516 CCTTGTACATAATTTAAGCTAGG + Intronic
970012617 4:11476383-11476405 ACAGATAAATAATTTTAGCTGGG + Intergenic
972503604 4:39699143-39699165 ACATGTAAATATTTTTAGTTAGG + Intronic
972669605 4:41202181-41202203 ATATGTACAGAATTTTAGTTGGG - Intronic
973370174 4:49239544-49239566 GCATATACATGATTTTAGAAAGG + Intergenic
973390854 4:49555868-49555890 GCATATACATGATTTTAGAAAGG - Intergenic
974853222 4:67428542-67428564 GAAAGTACTTAATTTTGGCTGGG + Intergenic
975087699 4:70363348-70363370 GCATATACATATTTGTAGATGGG + Intronic
975554380 4:75646102-75646124 GCATGTTAAGAATTTTGGCTGGG - Intronic
975648201 4:76566226-76566248 GCATTTACATTATATTAGGTAGG + Intronic
976909179 4:90279290-90279312 GTATGCACATAGTTTTATCTGGG + Intronic
982289402 4:153764724-153764746 TCATTTAAATAATGTTAGCTAGG + Intergenic
982423909 4:155234111-155234133 GAATGTAGATATTTTTAACTGGG - Intergenic
984307283 4:178009769-178009791 ACATGTAGATTATTTTGGCTTGG + Intergenic
984896532 4:184546510-184546532 GTATGTACATGGTTTCAGCTGGG + Intergenic
1202753907 4_GL000008v2_random:38322-38344 GGATGTACCTAATTCGAGCTGGG + Intergenic
1202757746 4_GL000008v2_random:81340-81362 GCTTTTACATAATATTAGGTGGG + Intergenic
1202767287 4_GL000008v2_random:159045-159067 GCATATACATGATTTTAGAAAGG + Intergenic
987350517 5:17017855-17017877 GAATGTACTTATTTTTGGCTGGG - Intergenic
989135853 5:38153964-38153986 GCATGTTTATAATTTTAGAGTGG + Intergenic
989235812 5:39147427-39147449 ATATGTACAAAAGTTTAGCTGGG - Intronic
989239039 5:39182522-39182544 TCATGCACATCATTTTAGCTGGG + Intronic
989270368 5:39526108-39526130 GCATTTTCATAATTTTAGTCTGG - Intergenic
990407043 5:55502140-55502162 GAAAATACATAATTTTATCTAGG + Intronic
995359302 5:111276429-111276451 TCATTTAAATAATTTTTGCTGGG + Intronic
995936115 5:117517067-117517089 TCATGAACACAATTTTAGGTAGG + Intergenic
995999224 5:118338737-118338759 ACATGTACATAATCTTAGCTTGG + Intergenic
998320694 5:141226989-141227011 ACATATACAAAAATTTAGCTAGG - Intergenic
1001185597 5:169568372-169568394 ACATGTACATTATTTTTTCTGGG + Intergenic
1002307104 5:178290271-178290293 CCATGAACATAATTTTGGTTAGG - Intronic
1005359400 6:25016705-25016727 GAATGTTCATAATTATAGCAAGG - Intronic
1006184438 6:32172915-32172937 GTATGTCCATAAGTTTACCTAGG - Intronic
1007942413 6:45794432-45794454 TGATGTAAATAATTCTAGCTGGG + Intergenic
1010054610 6:71550950-71550972 TCCTGTACAGAATTTGAGCTGGG - Intergenic
1011706862 6:90009529-90009551 GGATGTACATCAATTCAGCTGGG - Intronic
1013896527 6:115095168-115095190 GCATGAGTATAATTTAAGCTAGG + Intergenic
1014579045 6:123111824-123111846 GCATTTACAAACCTTTAGCTAGG - Intergenic
1014940164 6:127428921-127428943 GCATTTACAAACCTTTAGCTAGG + Intergenic
1016548857 6:145254938-145254960 GCCTATGCATAATGTTAGCTTGG + Intergenic
1016926495 6:149355175-149355197 TCATGTAAATAATTTTCACTGGG - Intronic
1017747886 6:157462999-157463021 GCATAAAGATAATTGTAGCTAGG + Intronic
1021026640 7:15676276-15676298 GCATGAACAGAATTTTATTTTGG - Intronic
1023551932 7:41378979-41379001 CCATGTAGATAATTTTAGGAAGG + Intergenic
1025844398 7:65183329-65183351 GCAGGCACATAATATTTGCTAGG - Intergenic
1025894727 7:65689663-65689685 GCAGGCACATAATATTTGCTAGG - Intergenic
1026658669 7:72279319-72279341 GCATGTACTTACTTAGAGCTTGG - Intronic
1027864948 7:83633624-83633646 GCATCTAAATAATTTTGGGTGGG - Intronic
1028164143 7:87518789-87518811 GAATGTAGATAATTGTACCTCGG - Intronic
1028428464 7:90718397-90718419 GCTGGTAAATAATTTTAGATAGG - Intronic
1028672629 7:93420710-93420732 ACATTAACAAAATTTTAGCTTGG + Intergenic
1030959996 7:115906821-115906843 GCTTGTAAATAATTTTGGTTTGG + Intergenic
1032010893 7:128347138-128347160 GAAAGTACAAAATATTAGCTGGG + Intergenic
1038505085 8:28077258-28077280 GCATGTCAATAATTTTAGGCAGG + Intronic
1041115708 8:54534251-54534273 GCATGTACATAATTTTGTTATGG - Intergenic
1041634053 8:60122338-60122360 CCATGGACATAATCATAGCTTGG - Intergenic
1043084665 8:75813821-75813843 CCCTTTACATAATTTTTGCTAGG + Intergenic
1043785858 8:84399072-84399094 TCATAAACATAATTTTATCTAGG - Intronic
1044644712 8:94426369-94426391 TCATGGACATAATGTTAGTTAGG - Intronic
1045428738 8:102093434-102093456 GAATGTAAATATTTTTAGCTAGG - Intronic
1048643616 8:136392355-136392377 GCTTGTACATAAATAAAGCTGGG + Intergenic
1050794915 9:9526315-9526337 GCATGGACATGATTTTCTCTAGG + Intronic
1052876511 9:33570967-33570989 GGATATACATAATTTTAGAAAGG - Intronic
1053499497 9:38573381-38573403 GGATATACATAATTTTAGAAAGG + Intronic
1053661712 9:40287748-40287770 GCATATACATGATTTTAGAAAGG - Intronic
1053912083 9:42917099-42917121 GCATATACATGATTTTAGAAAGG - Intergenic
1054373836 9:64433984-64434006 GCATATACATGATTTTAGAAAGG - Intergenic
1054522896 9:66088536-66088558 GCATATACATGATTTTAGAAAGG + Intergenic
1056587094 9:87935514-87935536 GGATATACATAATTTTAGAAAGG + Intergenic
1056609777 9:88117423-88117445 GGATATACATAATTTTAGAAAGG - Intergenic
1057103640 9:92389160-92389182 GCATGGTCATCATTTTATCTGGG + Intronic
1203757133 Un_GL000218v1:142522-142544 GGATGTACCTAATTCGAGCTGGG - Intergenic
1203707356 Un_KI270742v1:64640-64662 GCATATACATGATTTTAGAAAGG - Intergenic
1203716518 Un_KI270742v1:155189-155211 GGATGTACCTAATTCGAGCTGGG - Intergenic
1203534695 Un_KI270743v1:23046-23068 GGATGTACCTAATTCGAGCTGGG + Intergenic
1203538537 Un_KI270743v1:66204-66226 GCTTTTACATAATATTAGGTGGG + Intergenic
1203548040 Un_KI270743v1:143924-143946 GCATATACATGATTTTAGAAAGG + Intergenic
1203650747 Un_KI270751v1:118751-118773 GGATGTACCTAATTCGAGCTGGG - Intergenic
1187847108 X:23551298-23551320 GCTTCTAGATAATTTTACCTAGG - Intergenic
1188618259 X:32186600-32186622 ACATGTACATTATTTCAGCATGG + Intronic
1188766281 X:34095912-34095934 GCATTTACAAACTTTTAGCTAGG + Intergenic
1188816224 X:34718045-34718067 GCATGTCCAGAATTTTAGCCAGG - Intergenic
1191605115 X:63052684-63052706 ACATGTACACATTTTTACCTGGG - Intergenic
1192173160 X:68869237-68869259 CAAGGTAAATAATTTTAGCTAGG - Intergenic
1194053889 X:89105860-89105882 ACATGTAAATAACTTTAGTTTGG + Intergenic
1197429288 X:126341359-126341381 GCATGTACATGATTATTACTGGG - Intergenic
1197812946 X:130464386-130464408 GCATTTACATAATTTTTATTTGG - Intergenic
1198614875 X:138445777-138445799 GCTTGTACATAATTTTACTAAGG + Intergenic
1199447251 X:147939735-147939757 GAAAGTACAAAAATTTAGCTGGG + Intronic
1201170716 Y:11260142-11260164 GGATGTACCTAATTCGAGCTGGG - Intergenic
1201718807 Y:17075245-17075267 GTCTGTACACAATATTAGCTGGG - Intergenic