ID: 958677075

View in Genome Browser
Species Human (GRCh38)
Location 3:97278799-97278821
Sequence TGGCCTGCACACACCCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958677065_958677075 21 Left 958677065 3:97278755-97278777 CCCCATGGCCAGCAGGTTTCTCT 0: 1
1: 0
2: 3
3: 21
4: 254
Right 958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG 0: 1
1: 0
2: 2
3: 9
4: 182
958677069_958677075 13 Left 958677069 3:97278763-97278785 CCAGCAGGTTTCTCTAGGCACCT 0: 1
1: 0
2: 0
3: 16
4: 158
Right 958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG 0: 1
1: 0
2: 2
3: 9
4: 182
958677066_958677075 20 Left 958677066 3:97278756-97278778 CCCATGGCCAGCAGGTTTCTCTA 0: 1
1: 0
2: 0
3: 9
4: 143
Right 958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG 0: 1
1: 0
2: 2
3: 9
4: 182
958677074_958677075 -7 Left 958677074 3:97278783-97278805 CCTGATTTAGGGGTATTGGCCTG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG 0: 1
1: 0
2: 2
3: 9
4: 182
958677067_958677075 19 Left 958677067 3:97278757-97278779 CCATGGCCAGCAGGTTTCTCTAG 0: 1
1: 0
2: 1
3: 7
4: 174
Right 958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG 0: 1
1: 0
2: 2
3: 9
4: 182
958677064_958677075 22 Left 958677064 3:97278754-97278776 CCCCCATGGCCAGCAGGTTTCTC 0: 1
1: 0
2: 6
3: 64
4: 800
Right 958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG 0: 1
1: 0
2: 2
3: 9
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958677075 Original CRISPR TGGCCTGCACACACCCCTCA TGG Intronic
900186990 1:1337298-1337320 TGGCCTGCAGACGCCCCTGCTGG + Intronic
900953780 1:5874590-5874612 TGGCCTGCACACACCGGTGGAGG - Exonic
903550334 1:24153458-24153480 TTGCCTCCACACTCCCCTCCTGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906638651 1:47427523-47427545 TGCCCTGCCCAGCCCCCTCAAGG - Intergenic
909697326 1:78482516-78482538 TGGCAAGCACACACCTGTCATGG + Intronic
916170504 1:161998235-161998257 AGGCCTGCAGCCACCCGTCAGGG - Exonic
916406616 1:164503816-164503838 TGGCCTGCAAACTCCTTTCATGG - Intergenic
920804126 1:209216944-209216966 GTGCCAGCACACACCACTCAGGG + Intergenic
1064032363 10:11890983-11891005 TGCCCTGCCCTCTCCCCTCAGGG - Intergenic
1068777637 10:60885449-60885471 TCCCCTGAACACACCTCTCAAGG - Intronic
1071980554 10:91000759-91000781 AGTCCTGCTCACACCCCTGATGG - Intergenic
1073448046 10:103592679-103592701 AGGCCTGCAATTACCCCTCAGGG - Intergenic
1074912930 10:117927933-117927955 TGGGCTGTACACACCCCTGCAGG + Intergenic
1075275031 10:121085575-121085597 AAGCCTGCATACACCCCCCAGGG - Intergenic
1075926529 10:126255718-126255740 TGTCCTGGAGACAACCCTCATGG - Intronic
1076126793 10:127980691-127980713 TGGGCTTCAAACACACCTCATGG + Intronic
1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG + Intronic
1077430577 11:2514033-2514055 TGACCTGCACACCCCCCAAATGG - Intronic
1083558414 11:63651628-63651650 TGCCAAGCACACTCCCCTCAGGG + Intronic
1084004225 11:66314731-66314753 TGGGGTGCAGACCCCCCTCATGG - Exonic
1084692152 11:70733818-70733840 GTGCCTGCACAGACACCTCATGG - Intronic
1085433618 11:76479574-76479596 AGGCCTGCAGATACCCCTGAGGG + Intronic
1086838213 11:91652755-91652777 AGGCCTGGACTCACCCTTCAGGG + Intergenic
1089638775 11:119833308-119833330 TGGCCTGCACACCCCCGGGATGG - Intergenic
1089777981 11:120852323-120852345 TCACCTGCAAACACCCATCAGGG - Intronic
1091308683 11:134557779-134557801 TGGGCTCCACACACCCCTGCTGG - Intergenic
1091660188 12:2377418-2377440 TGACCTACTCACAGCCCTCAAGG + Intronic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1094695263 12:32811854-32811876 TGGCCTGCAGATACCCCTCAGGG - Intronic
1096692869 12:53331908-53331930 GGGACTGCACACATGCCTCATGG - Intronic
1100895527 12:99178265-99178287 TGGCCTACAGACACCCCTGTGGG - Intronic
1101257513 12:102993062-102993084 TGGCCTGAAGACACCCATAAAGG + Intergenic
1102159134 12:110754578-110754600 TGGCCTGCACCCAACCCTGCAGG + Intergenic
1103685264 12:122727426-122727448 TGGCCTCAAAACACCCCTCTAGG - Exonic
1104062839 12:125282488-125282510 TGGCCTGCACACACATCTCATGG + Intronic
1105407742 13:20145751-20145773 TTGCCTACACAGTCCCCTCAGGG + Intronic
1106964046 13:35038239-35038261 TGGCCTGGACTCAACCATCAGGG + Intronic
1111572768 13:90108343-90108365 TGGCCTACACGCACCCCTGTCGG - Intergenic
1113615981 13:111681029-111681051 TGGCCAGCCCACCCGCCTCAGGG - Intergenic
1113617647 13:111692626-111692648 TGGCCTGGACACACCCTTACAGG + Intergenic
1113621449 13:111765922-111765944 TGGCCAGCCCACCCGCCTCAGGG - Intergenic
1113623177 13:111777886-111777908 TGGCCTGGACACACCCTTACAGG + Intergenic
1117373140 14:55097068-55097090 TCACCTGCACATACCTCTCAAGG + Intergenic
1118321609 14:64756811-64756833 TGGCCTGGCCACAACCCTCAGGG - Intronic
1119322671 14:73740930-73740952 AGGACTGCACACACCCTTCTGGG - Intronic
1121414101 14:93767130-93767152 TGGTCTGCCCACCCCCTTCAAGG - Intronic
1121915458 14:97833727-97833749 TGGTTTACACACACACCTCAGGG - Intergenic
1122003655 14:98684736-98684758 TGGTCTCCCCACACCCCTCCAGG - Intergenic
1123048630 14:105530262-105530284 CGCCCTCCACACACCCCTCCTGG - Intergenic
1128147875 15:65342684-65342706 TTGCCTGCACTCCCCCCTCTTGG + Intronic
1130817964 15:87460472-87460494 TGCCCTACCCACATCCCTCAGGG + Intergenic
1131568340 15:93506533-93506555 TAGCCTGCAGGCACCCTTCAGGG - Intergenic
1131989209 15:98077093-98077115 GGGCCTGAACACACCTGTCATGG + Intergenic
1132601088 16:773315-773337 TGGACCCCACACACCCCCCAGGG - Intronic
1133282802 16:4676685-4676707 TGGCCTGCACACGTCACTAAAGG + Intronic
1136347800 16:29687488-29687510 TGGACTGGAGACAACCCTCAGGG + Intronic
1136616659 16:31402310-31402332 TGGCCTGCCCCCACCCCTCCCGG - Intronic
1137825589 16:51491831-51491853 ATGCCCCCACACACCCCTCAAGG + Intergenic
1138652795 16:58471332-58471354 TGATCTGCACACACCCCTGCTGG - Intronic
1141854480 16:86671783-86671805 TGGCCAGCTCCCACCCCTCGTGG - Intergenic
1141871289 16:86788500-86788522 TGGCCTCGACAGACCCCACAGGG - Intergenic
1143643033 17:8210432-8210454 TGGCCTGCGCGCACGCCGCAGGG - Intronic
1145264378 17:21372612-21372634 TGGGCTGCAGACACGCCTGAAGG + Intergenic
1145865121 17:28236206-28236228 TGGCCTGAAGACAACCCTCCAGG - Intergenic
1145877573 17:28331219-28331241 TGCCATGCACACACCTCTCTGGG - Intronic
1145978224 17:28996518-28996540 TGGGCTTCACTGACCCCTCAAGG - Intronic
1147882523 17:43663140-43663162 TCTCCTGCACCCACCCCCCAGGG - Intergenic
1149540704 17:57466041-57466063 AGGGCTGCCCACACTCCTCAGGG - Intronic
1150599368 17:66637241-66637263 TGGCATGCACATACTCCTGAGGG + Intronic
1151237967 17:72735323-72735345 CGGCCTGAACACAGTCCTCAGGG + Intronic
1151419615 17:73988624-73988646 TGGCATGCACACAGCTCTAAAGG + Intergenic
1151741563 17:75986226-75986248 TGGCCTGCACTAACCTCCCAGGG - Exonic
1152198314 17:78930347-78930369 TGCCCTGGACACTCCCCTGAGGG - Intergenic
1152241080 17:79161495-79161517 GGGCCTCCACACACCCCCGAGGG - Intronic
1152293757 17:79454992-79455014 AGGCCTGCACACACCCCATGGGG - Intronic
1152717850 17:81908461-81908483 GGGCCTGGACGCTCCCCTCACGG + Intronic
1154227441 18:12519079-12519101 TGGCCACCATCCACCCCTCAGGG - Intronic
1154518240 18:15197486-15197508 TGGCCTGGACACCTCCCTCAGGG - Intergenic
1157122398 18:44923856-44923878 TAGACTGCACACACTCCTCCAGG - Intronic
1159904442 18:74077386-74077408 TGGCGTGCACTCTCCCATCAGGG - Intronic
1160518696 18:79492160-79492182 TGCCCTCCTCAGACCCCTCAGGG - Intronic
1160678935 19:404464-404486 TGCCCCCCCCACACCCCTCAGGG - Intergenic
1160808744 19:1003742-1003764 TGGCCTGGACACCCTCCTAAGGG - Intronic
1161411042 19:4117626-4117648 TGCCCTGCAGAGACCCCCCAGGG + Exonic
1162087863 19:8259427-8259449 AGTCCTGCCCACAGCCCTCAAGG - Intronic
1163250491 19:16123874-16123896 TTTCCTGGAAACACCCCTCAGGG - Intronic
1163294622 19:16404327-16404349 TGCCCTGAACACACCCCACCTGG - Intronic
1163404472 19:17113629-17113651 TGCCCAGCTCACCCCCCTCAGGG - Intronic
1163424224 19:17232301-17232323 AGGCCTGCAGACAGACCTCAAGG - Exonic
1165453106 19:35896526-35896548 TGGCCTGCAGACCCCTCTCCTGG - Exonic
1167686824 19:50961812-50961834 AGGCATGCTCACACTCCTCACGG + Exonic
1168351450 19:55678464-55678486 TGGCCTGCCCAGAGCCCTCAGGG - Intronic
926739817 2:16101991-16102013 GGGGCTGCACCCACCCCACAGGG + Intergenic
927794257 2:26034323-26034345 TGGCCTCCCCTCCCCCCTCAGGG - Exonic
929083016 2:38139568-38139590 TGGCCTCCACCCAGCCCTGATGG - Intergenic
931708392 2:64966902-64966924 TGGCCAGCAAATACACCTCATGG - Intergenic
935641521 2:105295015-105295037 TGGTCTGCACCCTCCCCTCCAGG + Intronic
937409708 2:121663099-121663121 TCACCTGCACACACACTTCAAGG + Intergenic
937713595 2:125006969-125006991 TGGCCTGCACAGAGATCTCATGG - Intergenic
938097865 2:128475206-128475228 TGGCCGGCCCCCACTCCTCATGG - Intergenic
938187347 2:129243265-129243287 TTGCCTGGGCCCACCCCTCAGGG - Intergenic
938412440 2:131076059-131076081 TGGACTGCACAAAACCCACAGGG + Intronic
939318655 2:140586481-140586503 GGGCTTCCACACACCCCTGATGG + Intronic
947126081 2:226869860-226869882 TGGCCTGCACATCTCCCTCCTGG - Intronic
948335171 2:237201820-237201842 TGGCCTGCACAGGCCTCCCAAGG + Intergenic
948722061 2:239906655-239906677 TGCCCTGCACCCAACCCTAAAGG + Intronic
948795303 2:240399511-240399533 TGGCCTTCTCAGCCCCCTCAGGG - Intergenic
949000447 2:241610169-241610191 TGGCCTTCACACTCCCCACGAGG + Intronic
949023473 2:241754048-241754070 TGGCAGGCACGCGCCCCTCAGGG - Intronic
1175045968 20:56106070-56106092 TGGCCTGGACACCACCCTCCTGG - Intergenic
1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG + Intergenic
1176117565 20:63439739-63439761 GGGCCTGCTCACACCCCTGAGGG + Intronic
1176371640 21:6065939-6065961 TGGGCCCCACACACCTCTCATGG + Intergenic
1176386800 21:6142042-6142064 TGGCCTGCATGCGGCCCTCATGG + Intergenic
1179148198 21:38787570-38787592 TGGCTTGCACAATCCCCTCTGGG + Intergenic
1179736673 21:43396210-43396232 TGGCCTGCATGCGGCCCTCATGG - Intergenic
1179751879 21:43472600-43472622 TGGGCCCCACACACCTCTCATGG - Intergenic
1182711976 22:32328896-32328918 TGGCCTGCACACCCCAGTGATGG + Intergenic
1183385921 22:37514563-37514585 TGGCCTCAACACCCCCATCAGGG + Intronic
1183776774 22:39971307-39971329 TGCCTTCCACACACCCCTGAGGG - Exonic
1185082839 22:48719157-48719179 TGGCCTGCACACACCCGCAGGGG + Intronic
949861912 3:8513315-8513337 TGGCCAGCACGCATCCCCCAGGG + Intronic
949861980 3:8513936-8513958 TGGCCAGCAGACATCCCCCAGGG - Intronic
950485108 3:13268711-13268733 TGGAATGCACACACCCCTAGGGG - Intergenic
952738488 3:36713491-36713513 TGGGCAGCACCCACTCCTCAGGG + Exonic
952956956 3:38563445-38563467 TTGCCCCCACTCACCCCTCAAGG + Intronic
953389674 3:42526988-42527010 TGCCCTTCAGACACCCCTCGAGG - Intronic
953906605 3:46871602-46871624 TGGTCTCCCCACAGCCCTCAAGG - Intronic
954384591 3:50237499-50237521 TGGGCTGCCCACACCCCTTCTGG + Intronic
954653074 3:52177134-52177156 TGCCCTACACACAGGCCTCAAGG + Intergenic
954806306 3:53222873-53222895 TGCCCTACACACACCCATCTTGG + Intergenic
954939936 3:54362510-54362532 TGTGCTGCACACTCCCCTCCCGG - Intronic
955032761 3:55237050-55237072 GCTCCTGCACACACCCTTCATGG - Intergenic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
964640029 3:158899382-158899404 TGACCTGCACACAGTCCTCTGGG + Intergenic
965074556 3:163959825-163959847 TTGCCTGCACACACACCTGGCGG + Intergenic
965868583 3:173237894-173237916 TGGCCTGCACAGAATCTTCAGGG + Intergenic
966786152 3:183624759-183624781 TGCCCTGCTCACCGCCCTCATGG - Intergenic
968664026 4:1810927-1810949 AGGCCATCACACATCCCTCAGGG + Intergenic
970943372 4:21661493-21661515 TGGCATGCTCAAACCCCTTATGG - Intronic
971346509 4:25816525-25816547 AGGCCTGCATCCACTCCTCAAGG + Intronic
971981425 4:33756135-33756157 TGTCCTTCACACACCCCTATTGG + Intergenic
981329238 4:143488823-143488845 TGGCCTGAATGCACCCTTCAGGG - Intergenic
985659806 5:1151456-1151478 TGGGCTGCACACAACCCTCCAGG + Intergenic
985709604 5:1420886-1420908 TGTCCTGCACACCCTCCCCAGGG + Intronic
985817188 5:2135703-2135725 TGGGCTCCACACTCCCCACAAGG - Intergenic
987825526 5:23026106-23026128 TGGCCTGCACACACACTGAATGG - Intergenic
989370351 5:40700504-40700526 TGGGTTGCACACACTCCCCATGG + Intergenic
990169940 5:53036862-53036884 AGGCCTGGACACACCATTCAAGG + Intronic
991002403 5:61795518-61795540 TGGCCAGAACACACTCCACAGGG + Intergenic
997294080 5:132759202-132759224 TGGCCTCCACAGAGCCGTCATGG + Intronic
997446088 5:133941466-133941488 TGGCCTGAACTCTCCCCTCATGG + Intergenic
997656790 5:135561155-135561177 TTCCGTGCACACACCCCTCATGG - Intergenic
1002462025 5:179378651-179378673 GGGCCTTCATGCACCCCTCAGGG + Intergenic
1003210566 6:4061010-4061032 TGGCCTGCACACACACACCTAGG - Exonic
1005170034 6:22973087-22973109 AGGCCTGCAGACACCCCTATGGG + Intergenic
1008555734 6:52671381-52671403 TGCCCTGCAAAATCCCCTCAAGG - Intronic
1008610830 6:53183199-53183221 AGCTCTGCACACGCCCCTCAGGG - Intergenic
1011370714 6:86633991-86634013 AGGCCTCCAGCCACCCCTCATGG - Intergenic
1011773886 6:90706926-90706948 TGGGGTGCACACACGCCTCCTGG - Intergenic
1014768582 6:125435493-125435515 GGGCCTACACTCATCCCTCAGGG - Intergenic
1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG + Intronic
1021184040 7:17542246-17542268 AGGCCTGCCCACTCCCCTCCCGG + Intergenic
1022332987 7:29397717-29397739 GGGCCAGCACACAACCCTCCCGG + Intronic
1024137573 7:46426272-46426294 TGAGGAGCACACACCCCTCAGGG + Intergenic
1026416201 7:70183460-70183482 TTGCCTGCCCCCTCCCCTCATGG + Intronic
1027951550 7:84823148-84823170 TGACCTGCACACACACATCCAGG + Intergenic
1034165585 7:149022732-149022754 CAGCCTGCACCCACCCCACATGG + Intronic
1034337073 7:150330605-150330627 TGGCCAGCACAAACTCCTCGCGG - Exonic
1034959244 7:155354543-155354565 TCACCTGCACACACCACACATGG + Intergenic
1035101161 7:156397835-156397857 TTCCCTGCACACTCCCCACAGGG - Intergenic
1035378015 7:158419710-158419732 TGGCCAGCATTCACCACTCAGGG + Intronic
1037696871 8:21231066-21231088 TCCACTGCACACACTCCTCAAGG + Intergenic
1038409672 8:27348437-27348459 CGGCGTGCACACACACCTCCTGG + Intronic
1040382698 8:46888212-46888234 TTGCCTGGACACTCCCCACACGG - Intergenic
1041579865 8:59446663-59446685 TGGCCTGGTCAACCCCCTCATGG - Intergenic
1042654930 8:71085430-71085452 TGGCCTGCACTGAAGCCTCATGG + Intergenic
1044531625 8:93314222-93314244 TGGCCTGGACCCAGCCCTCTCGG + Intergenic
1048327515 8:133450818-133450840 AACCCTGCACCCACCCCTCATGG + Intergenic
1049164524 8:141117853-141117875 TGGGCAGCAGACACCCCTCCTGG + Intronic
1049450768 8:142660282-142660304 AGGCCACCACCCACCCCTCACGG + Intronic
1053204467 9:36174333-36174355 TGGCCTGGACTCACCCTTCAGGG - Intergenic
1057219531 9:93248481-93248503 TGGCCTTCACATTCCCCCCAAGG - Intronic
1057834781 9:98435622-98435644 TGGCCTCCACCCACCACTCCAGG + Intronic
1060525691 9:124320152-124320174 GGGCCAGCACACCCACCTCAGGG + Intronic
1061089217 9:128417493-128417515 TCCCCTGCCCACTCCCCTCAGGG - Intronic
1062034821 9:134378332-134378354 TGGCCGGCACACACGCCTTCAGG - Intronic
1186672493 X:11781562-11781584 TGGCCTGGACAGCCACCTCATGG + Intergenic
1188259975 X:28011068-28011090 AGGCCTGCAGACACCCCTGTGGG + Intergenic
1191211816 X:57892469-57892491 TGGGCTGCACCCTGCCCTCATGG + Intergenic
1196336202 X:114538761-114538783 TGGCATGCACACAGTCATCATGG - Intergenic
1198938878 X:141931322-141931344 TGGCCTGGTCTCACCCTTCAGGG + Intergenic
1199715838 X:150506841-150506863 TGCCCAGCACACAACCCCCAGGG + Intronic