ID: 958677945

View in Genome Browser
Species Human (GRCh38)
Location 3:97291869-97291891
Sequence AATCTAAGCAGAGGCACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958677945_958677950 10 Left 958677945 3:97291869-97291891 CCAGCTGTGCCTCTGCTTAGATT 0: 1
1: 0
2: 1
3: 25
4: 229
Right 958677950 3:97291902-97291924 CTGCTGGACTTGTGCCTGGCAGG 0: 1
1: 0
2: 4
3: 18
4: 232
958677945_958677948 6 Left 958677945 3:97291869-97291891 CCAGCTGTGCCTCTGCTTAGATT 0: 1
1: 0
2: 1
3: 25
4: 229
Right 958677948 3:97291898-97291920 GTGCCTGCTGGACTTGTGCCTGG 0: 1
1: 0
2: 3
3: 22
4: 213
958677945_958677947 -6 Left 958677945 3:97291869-97291891 CCAGCTGTGCCTCTGCTTAGATT 0: 1
1: 0
2: 1
3: 25
4: 229
Right 958677947 3:97291886-97291908 TAGATTTTGCTTGTGCCTGCTGG 0: 1
1: 0
2: 6
3: 21
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958677945 Original CRISPR AATCTAAGCAGAGGCACAGC TGG (reversed) Intronic
901340588 1:8495292-8495314 AATAGGAGCAGAGGCAGAGCTGG - Intronic
902229804 1:15020861-15020883 ACTCTAAGGAGCGGCAGAGCTGG + Intronic
902933009 1:19744686-19744708 ATTCCAAGCAAAGGGACAGCAGG - Intronic
903762717 1:25710202-25710224 AATCTAGGAAGTGGCAGAGCAGG - Intronic
906575553 1:46886304-46886326 AATCTAAGGAGAGGGAGAGAAGG + Intergenic
906596423 1:47081592-47081614 AATCTAAGGAGAGGGAGAGAAGG - Intronic
908164138 1:61441056-61441078 AAGCTAATCAGAGACAGAGCAGG + Intronic
908177183 1:61567145-61567167 AGTCTAAGCTGAGGCACAAGAGG + Intergenic
908606837 1:65807236-65807258 AATCTATGCAGAGGGACAGCTGG - Intronic
909610011 1:77541635-77541657 ACTCAAGGCTGAGGCACAGCAGG + Intronic
910274334 1:85432134-85432156 AGTCTAGGGAGAGGCACAGAAGG - Intronic
910419244 1:87039383-87039405 AAGATAAGCAGAGGCACATCAGG - Intronic
912663166 1:111553126-111553148 CTTGTAAGCAGAGGCACAGATGG + Intronic
917936201 1:179869561-179869583 AATCTGCTCAGAGGCAAAGCAGG + Intronic
918008292 1:180562560-180562582 AAGTCAAGCAGAGGCACAGGTGG + Intergenic
918025853 1:180745301-180745323 AAGCTAAGCAGTGGAACAGGAGG + Intronic
918312326 1:183293600-183293622 AATCTTAGCAGAGACAGAGCGGG + Intronic
920967220 1:210711270-210711292 CATCTTAGCAGAGGCCCAGGTGG - Intronic
921181385 1:212634391-212634413 AATCTAGGCACAAACACAGCAGG + Intergenic
921299721 1:213739096-213739118 TATCTCAGCAGAGGCAGAGGTGG - Intergenic
921377984 1:214493657-214493679 AATCTATTCAGAGACACAGTGGG + Intronic
922171775 1:223161655-223161677 AATCTCATCAGAGGCACCTCAGG + Intergenic
923786031 1:237070538-237070560 AACCCAAGCAGAGGCACCACTGG - Intronic
924723248 1:246643510-246643532 ACTCAAAGCAGAGGCCAAGCAGG - Intronic
924803296 1:247343578-247343600 AATCTAAGCAGATGCCCTGCTGG - Intergenic
1063339889 10:5253108-5253130 GTTCTAAGCATAGGCACAGTGGG - Intergenic
1063343849 10:5293542-5293564 GTTCTAAGCATAGGCACAGTGGG + Intergenic
1063472211 10:6297227-6297249 AATCAAGGCAGATGCATAGCAGG - Intergenic
1066454451 10:35560964-35560986 AAGATGAGCAGAGGCACTGCCGG + Intronic
1068068330 10:52162879-52162901 AACCTTAGCAGAGGCATTGCAGG - Intronic
1068919434 10:62466542-62466564 AACCCAAGCAGAGGCACTGCTGG + Intronic
1070080618 10:73182788-73182810 AATTTATATAGAGGCACAGCAGG - Intronic
1070113646 10:73508422-73508444 AATTTAAGCAGAGGTAGAGGTGG + Intronic
1071018753 10:81028134-81028156 AATCTATGCAGAGGAAGAGTGGG - Intergenic
1072445228 10:95493561-95493583 GATCTAGGCTGAGGCAAAGCCGG + Intronic
1072550668 10:96474844-96474866 AAGCTAAGCAGAGACAAAGGTGG - Intronic
1072560836 10:96572347-96572369 CAGGTAAGCAGAGGCAAAGCTGG + Intronic
1073142513 10:101258161-101258183 AATCTAAGCAGAAGTGCTGCAGG + Intergenic
1073792633 10:106955492-106955514 AACTCAAGCAGAGGCACTGCCGG + Intronic
1073890478 10:108096006-108096028 AACCCAAGCAGAGGCACCGCTGG - Intergenic
1074738773 10:116464385-116464407 AACTCAAGCAGAGGCACTGCAGG - Intronic
1078403928 11:11052090-11052112 AATGAAAGGAGAGGCCCAGCGGG - Intergenic
1079687174 11:23373751-23373773 AATGTAAGAAGAGGCAAAGAAGG + Intergenic
1079816168 11:25061476-25061498 GATCTAAGGAGAAACACAGCTGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085158006 11:74313704-74313726 TCTAGAAGCAGAGGCACAGCTGG - Intergenic
1085471585 11:76761793-76761815 AATCTGGGCAGAGTCACAGCTGG - Intergenic
1086003831 11:82012624-82012646 AAGTTAATCAGAGGCAAAGCTGG - Intergenic
1089707581 11:120291183-120291205 AATCTCAGTAGGGGAACAGCAGG + Intronic
1091216225 11:133903948-133903970 AATCTAAAAAGAAGCAGAGCTGG + Intergenic
1091779924 12:3207397-3207419 AATGTGAGCAGAGACAAAGCTGG - Intronic
1093812087 12:23503743-23503765 TATCTAAGTCAAGGCACAGCTGG + Intergenic
1099662958 12:85589335-85589357 GATCTTAACAGAGGCACATCTGG - Intergenic
1099909122 12:88808113-88808135 AATCTATGCAGATATACAGCAGG - Intergenic
1101081780 12:101193963-101193985 AACATAAGCAGAGGCAAAGATGG + Intronic
1101642831 12:106601070-106601092 AATGAAAGCAGAGGCAGGGCAGG + Intronic
1105211705 13:18260962-18260984 ATTCCTAGCAGAGGAACAGCTGG - Intergenic
1106029070 13:25983149-25983171 AATCAAAGCAGACACACAGAAGG - Intronic
1107106868 13:36653088-36653110 ACTCTATGCAGAGACAAAGCAGG + Intergenic
1108375396 13:49809444-49809466 AATGAAAACAGAGGCCCAGCTGG - Intergenic
1108595601 13:51945953-51945975 CAGCTAACCAGAGGCAGAGCTGG - Intronic
1110061294 13:71041086-71041108 GACCTAAGGAGAGGCACAGTTGG - Intergenic
1110897581 13:80774267-80774289 AAGGTAAGCAGAGACTCAGCAGG + Intergenic
1112471477 13:99693618-99693640 AACCCAAGCAGAGGCAAGGCTGG + Intronic
1115463552 14:33688519-33688541 AATGCAAGCAGAGTCACAGATGG + Intronic
1117451165 14:55851532-55851554 CAGCTGAGCAGGGGCACAGCAGG - Intergenic
1123180893 14:106469162-106469184 GATCTGAGCAGAGCCACTGCTGG + Intergenic
1202946003 14_KI270726v1_random:27496-27518 GATCTGAGCAGAGCCACTGCTGG - Intergenic
1126042476 15:44605433-44605455 AATATAGGCAGAGGCACCACAGG + Intronic
1127597666 15:60502865-60502887 AACCTAAGCAGAGGCAGAAATGG + Exonic
1127818459 15:62633591-62633613 TATGTAAACAGAGGCATAGCTGG - Intronic
1128788073 15:70412902-70412924 CCTCTAAGCAGAGACATAGCAGG - Intergenic
1129210580 15:74065707-74065729 ATTCTCAGCCGAGGGACAGCAGG - Intergenic
1129403431 15:75299622-75299644 ATTCTCAGCCGAGGGACAGCAGG + Intergenic
1130271890 15:82456024-82456046 ATTCTCAGCTGAGGGACAGCAGG - Intergenic
1130282526 15:82531159-82531181 ATTCTCAGCCGAGGGACAGCAGG + Intergenic
1130464240 15:84183411-84183433 ATTCTCAGCTGAGGGACAGCAGG - Intergenic
1130488446 15:84411408-84411430 ATTCTCAGCTGAGGGACAGCAGG + Intergenic
1130500026 15:84490124-84490146 ATTCTCAGCTGAGGGACAGCAGG + Intergenic
1130586538 15:85188046-85188068 ATTCTCAGCTGAGGGACAGCAGG - Intergenic
1130679026 15:85980441-85980463 AATCAAGGCAGAGGCAAAGCAGG + Intergenic
1131892274 15:96984851-96984873 AATTTACTCAGAGGCAGAGCTGG + Intergenic
1134093517 16:11404054-11404076 GATCTGAGCAGAGGCACTTCAGG - Intronic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1135031453 16:19042094-19042116 TATCCCAGCAGAGGCACAGAAGG + Intronic
1135291710 16:21244989-21245011 AGTGTGAGCAGAGGCACAGATGG - Intronic
1135805021 16:25534748-25534770 AAAGTATGCAGAAGCACAGCAGG + Intergenic
1135838041 16:25845532-25845554 AATCTAAGAAGAGGAAATGCTGG + Intronic
1136141454 16:28291757-28291779 ATTCTAGGCAGAGGTACAGCAGG - Intergenic
1136355708 16:29744075-29744097 TAGCTGAGCAGAGGCACTGCTGG + Exonic
1136615735 16:31397506-31397528 AAGCTAAGCGGGGGCACAGTTGG - Intronic
1137372871 16:47924919-47924941 TGTATAAGCAGAGGCACAGTGGG + Intergenic
1137554580 16:49462451-49462473 AATCTAAACGGAGACAAAGCAGG + Intergenic
1138343634 16:56306947-56306969 GATCTCCTCAGAGGCACAGCAGG - Intronic
1146596957 17:34177651-34177673 AGTATAAGAAGAGGCACATCTGG - Intergenic
1146681600 17:34812256-34812278 AATGTTAACAGAGGCACAACAGG + Intergenic
1148347782 17:46915113-46915135 AATTCAACCAGAGGCTCAGCTGG + Intergenic
1148659388 17:49316258-49316280 ACTTTAAGCAGAGGCTGAGCTGG - Intronic
1148911100 17:50943452-50943474 AAGCTGAGCAGACACACAGCCGG + Intergenic
1149340478 17:55680918-55680940 AATCTGTGCAGAGGCAGATCTGG + Intergenic
1203166643 17_GL000205v2_random:103249-103271 TATCTAATCAGGTGCACAGCTGG + Intergenic
1153017019 18:592382-592404 AATCAAAGAAGAGGCAGAGAAGG - Intergenic
1154913311 18:20687072-20687094 AATCTAGACAGAGGCACTGTCGG + Intergenic
1154916034 18:20728530-20728552 AATCTAGACAGAGGCACTGTCGG + Intergenic
1154922017 18:20821348-20821370 AATCTAGACAGAGGCACTGTCGG - Intergenic
1156181569 18:34611630-34611652 AATCTTAGAAGGGGCACAGGGGG + Intronic
1157454043 18:47810360-47810382 AACCTGAGCAGAGGCACAGTGGG - Exonic
1157649214 18:49311129-49311151 GGTCTAAGCAGAGGGACAACAGG + Intronic
1160689940 19:456874-456896 GTTCTAGGCAGGGGCACAGCAGG - Intronic
1162061947 19:8101491-8101513 GTTCTAGGCAGGGGCACAGCAGG - Intronic
1163096652 19:15062943-15062965 ATTTTAAGAAGATGCACAGCAGG - Intergenic
1165002428 19:32776058-32776080 AAGCTAAGCAGATGCAGAACAGG - Intronic
1165232737 19:34397148-34397170 ACTCTAAGCAGAGACACATCAGG - Intronic
1165759217 19:38310755-38310777 GTTCCAAGCAGAGGCACAGCTGG - Intronic
1168450535 19:56462982-56463004 ATTCCAGGTAGAGGCACAGCAGG + Intronic
926241989 2:11095648-11095670 ATTCCAGGCAGAGGAACAGCAGG + Intergenic
926462905 2:13155201-13155223 TATCTAAGAAGAGGCACCACAGG + Intergenic
926547893 2:14264513-14264535 ACTCTAAATAGAAGCACAGCTGG + Intergenic
926994982 2:18724962-18724984 AGTCTAGGAAGAGGCAGAGCGGG + Intergenic
927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG + Intergenic
928175917 2:29034254-29034276 AGGATAAGCAAAGGCACAGCAGG - Intronic
931206265 2:60148916-60148938 AATCTAAGCAGAGGCAGCATGGG + Intergenic
932082397 2:68726856-68726878 AAGCTCAGCAGAGGCAGACCTGG - Intronic
933450893 2:82449783-82449805 AATCTAAGAAGAGACAAAGAAGG + Intergenic
934301920 2:91781493-91781515 ATTCCTAGCAGAGGAACAGCTGG + Intergenic
936780698 2:116029152-116029174 AATCTAAAGTGAGGCACAGCAGG + Intergenic
939964986 2:148601466-148601488 ATTCTAATCAGAAGCCCAGCTGG - Intergenic
941637889 2:167955648-167955670 GATCTAAGCAAAGGCACAGTTGG + Intronic
943562570 2:189481717-189481739 AATCTAGGCAGAGGCAGAACTGG - Intergenic
944642713 2:201744401-201744423 TATATAAGCAGAGTGACAGCAGG - Exonic
944686912 2:202125721-202125743 AATCTGAGGAGAGGCAGACCTGG - Intronic
946862735 2:224015303-224015325 AATGGAAGCAGAGGCACACCTGG + Intronic
947164782 2:227250777-227250799 ATTCTAGGCAGAGGGAGAGCAGG + Intronic
947464990 2:230335763-230335785 CATCTATGCAGTGGCAGAGCTGG - Intronic
948143115 2:235688870-235688892 AGTCTAAACACAGGCACAGTTGG - Intronic
948171677 2:235908488-235908510 GATGTAAGGAGAGACACAGCAGG - Intronic
1168802281 20:651330-651352 TATGTAAGCAAAGGCAGAGCTGG + Intronic
1169686125 20:8274443-8274465 AATCCAAACAGAGGCAGAGAGGG - Intronic
1174082789 20:47983005-47983027 ATCCCAAGCAGAGGCACAGCAGG + Intergenic
1174133167 20:48359977-48359999 ACCCCAAGCAGAGGCACAGCAGG - Intergenic
1174170868 20:48617573-48617595 AATCTGAGCCGAGGCCCATCTGG + Intergenic
1175205590 20:57308822-57308844 AATCTCAGCAGGGTCACAGTGGG + Intergenic
1176334899 21:5587317-5587339 TATCTAATCAGGTGCACAGCTGG - Intergenic
1176392858 21:6233631-6233653 TATCTAATCAGGTGCACAGCTGG + Intergenic
1176405109 21:6355848-6355870 TATCTAATCAGGTGCACAGCTGG - Intergenic
1176432048 21:6633256-6633278 TATCTAATCAGGTGCACAGCTGG + Intergenic
1176468561 21:7082543-7082565 TATCTAATCAGGTGCACAGCTGG - Intronic
1176492122 21:7464321-7464343 TATCTAATCAGGTGCACAGCTGG - Intergenic
1176508520 21:7674062-7674084 TATCTAATCAGGTGCACAGCTGG + Intergenic
1178946198 21:36949770-36949792 GCTCAAAGCAGAGTCACAGCTGG + Intronic
1179234295 21:39531241-39531263 ATTCTAAGCAGAGCCTCAGAGGG + Intergenic
1180814510 22:18781226-18781248 ATTCCTAGCAGAGGAACAGCTGG - Intergenic
1180947485 22:19704671-19704693 AAACAAAACAGAGGCACAACTGG - Intergenic
1181200698 22:21215562-21215584 ATTCCTAGCAGAGGAACAGCTGG - Intronic
1181461121 22:23086553-23086575 AAGCACAGCAGAGCCACAGCTGG + Intronic
1181701043 22:24621411-24621433 ATTCCTAGCAGAGGAACAGCTGG + Intronic
1183238864 22:36640808-36640830 AATCTAAACTGAGGGACATCAGG - Intronic
1183455564 22:37921175-37921197 TGTGTAAGTAGAGGCACAGCTGG + Intronic
1184768101 22:46582451-46582473 AGTGACAGCAGAGGCACAGCTGG - Intronic
1185289405 22:50016083-50016105 AACCTGAGCCCAGGCACAGCAGG - Intronic
1203226219 22_KI270731v1_random:79873-79895 ATTCCTAGCAGAGGAACAGCTGG + Intergenic
1203264609 22_KI270734v1_random:6913-6935 ATTCCTAGCAGAGGAACAGCTGG - Intergenic
951352067 3:21618361-21618383 AAGCTAAGAAGAGGCAAAGAAGG + Intronic
952512486 3:34071162-34071184 AGCCTCAGGAGAGGCACAGCTGG + Intergenic
954214392 3:49116347-49116369 CATCCCTGCAGAGGCACAGCAGG + Exonic
955709082 3:61760075-61760097 TATCTAAGCAGTAGTACAGCTGG + Intronic
956029015 3:65016474-65016496 AATCTAAGCAGAGAAAGAGAGGG - Intergenic
957502583 3:81076283-81076305 AATATAAGCAGAGACAGAGTAGG + Intergenic
958677945 3:97291869-97291891 AATCTAAGCAGAGGCACAGCTGG - Intronic
959496037 3:107053048-107053070 AAGCCAAGCAGAGGCAAAGCTGG + Intergenic
961096881 3:124164939-124164961 AATATAAGGAGAGGCCCAGAGGG - Intronic
961143391 3:124574361-124574383 AACATAAGCAAAGTCACAGCAGG - Intronic
964479334 3:157126540-157126562 AATCTAAGTTGAGTGACAGCAGG + Intergenic
966809312 3:183829227-183829249 AGGCTAAGCAGAGGCACTGGAGG + Intergenic
968035726 3:195545862-195545884 AACCTCAGCAGAGGCACAGAAGG - Intergenic
968911317 4:3478179-3478201 CCTCTAAGCCGGGGCACAGCAGG + Intronic
969665370 4:8554282-8554304 AATCCCAGCAGATTCACAGCAGG - Intergenic
969838251 4:9860876-9860898 AATCCAGGCAGAGGAGCAGCTGG - Intronic
971246126 4:24929682-24929704 AACATAAGCAGAGGCACAGAGGG - Intronic
972404017 4:38729940-38729962 AATCAAGGCACAGGCAGAGCTGG + Intergenic
975008602 4:69321573-69321595 AACTCAAGCAGAGGCACTGCCGG + Intronic
975844472 4:78510631-78510653 AATCTATGCAGAGGCAATGTAGG - Intronic
976219923 4:82748188-82748210 AATCTAGACAGAGTCAAAGCAGG + Intronic
977611103 4:99032515-99032537 AATTTAGGTACAGGCACAGCAGG - Intronic
978041810 4:104073923-104073945 AATCTGAGCAGAGACATAACTGG + Intergenic
980493849 4:133565860-133565882 AATTTAAGCAAAGGTAGAGCTGG + Intergenic
982219944 4:153115692-153115714 CATCAAAGAAGAGGCCCAGCAGG - Intergenic
982230543 4:153204768-153204790 AATCGAGGGAGAGACACAGCTGG + Intronic
982369957 4:154624025-154624047 AATTGAAGAAGAGGCACAGAGGG - Intergenic
982900893 4:161002410-161002432 AACCCAAGCAGAGGCACTGCTGG - Intergenic
983945447 4:173581560-173581582 AAACAAAGCAGAGGCCAAGCAGG + Intergenic
988640899 5:33040287-33040309 AACTCAAGCAGAGGCACTGCTGG - Intergenic
988941975 5:36156113-36156135 TACCTAAGGAGAGGCACAGAGGG + Intronic
989755457 5:44947801-44947823 AACCTAAGAAGAGGCAGAGCAGG - Intergenic
991447965 5:66720654-66720676 AATATAAACAGTGGAACAGCTGG - Intronic
992029542 5:72708133-72708155 AACCCAAGTAGAGGCACTGCTGG - Intergenic
992440162 5:76791054-76791076 AAACAGAGCAGAGGCACATCTGG + Intergenic
992586131 5:78242264-78242286 GATCTGAGCAGAGGCATAGTGGG - Intronic
995146157 5:108788455-108788477 AACCCAAGCAGAGGCACCACTGG + Intronic
999173428 5:149614772-149614794 AAGCTAAGAATAGGCAGAGCAGG - Intronic
999194517 5:149773086-149773108 ACTCTAAGCATGGGCAGAGCTGG - Intronic
999271595 5:150299659-150299681 AATCCAAGCAGAGTCTAAGCAGG + Intronic
999540480 5:152566244-152566266 AATCTGAGTAGATGCAGAGCTGG - Intergenic
999650935 5:153766796-153766818 TACCTAATGAGAGGCACAGCTGG + Intronic
1001254187 5:170171146-170171168 ACTCTAAGCCCAGGCAGAGCTGG + Intergenic
1001954844 5:175842151-175842173 CAGCAAAGCAGTGGCACAGCAGG + Intronic
1006143070 6:31942692-31942714 GAACTAGGCAGAGGCACAGCTGG + Intronic
1006581972 6:35082488-35082510 AGCCACAGCAGAGGCACAGCAGG - Intronic
1007637274 6:43307016-43307038 AAGCTAGTCAGAGGCAAAGCTGG - Intronic
1011322597 6:86113339-86113361 ACTATAAGCAGAGACAAAGCAGG - Intergenic
1011820331 6:91245511-91245533 ACTCTTTGCAGGGGCACAGCTGG + Intergenic
1012037798 6:94165566-94165588 AAGCTAAGCAGAAGCCCATCTGG + Intergenic
1012227351 6:96719295-96719317 AAGCTAGGAAGAGGCACAGTAGG + Intergenic
1014617600 6:123623006-123623028 AATTTGAGGAGAGGCACAGGTGG - Intronic
1015615233 6:135067512-135067534 AATCTCAGCAAAGGCACTACTGG - Intronic
1017049302 6:150375532-150375554 ATTCTATGCATAGGAACAGCGGG + Intronic
1018104439 6:160469319-160469341 AATTGAATAAGAGGCACAGCAGG + Intergenic
1018237237 6:161738540-161738562 AATCAAAGCACAGGCACCACAGG + Intronic
1018707703 6:166475159-166475181 AGTCTAAGCAGAAGCACCACAGG - Intronic
1019112437 6:169726627-169726649 CAGCTAATAAGAGGCACAGCTGG - Intergenic
1020239021 7:6378011-6378033 AGTGTAAGCAGAGGCACAGGAGG - Intronic
1020968077 7:14898247-14898269 AATGTAAGCAGAGACAAAGAAGG + Intronic
1020971018 7:14939118-14939140 AATATAGGCAGAGGCACCACAGG - Intronic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1028551107 7:92067279-92067301 CATCTAAGCAGAGACAGAGTAGG - Intronic
1028888331 7:95959276-95959298 AATTTTAGCAGGGGCACAACAGG + Intronic
1029597083 7:101543641-101543663 ACCCTAAGCAGAGAGACAGCAGG + Intronic
1031111344 7:117613334-117613356 AATCAAATCAGATGCTCAGCCGG + Intronic
1035139332 7:156741539-156741561 AATGTAAGAAGAGACACAGAAGG + Intronic
1035731393 8:1856040-1856062 AATCGAAGCAGGGGGAGAGCTGG - Intronic
1039173209 8:34772935-34772957 AGTATCAGCAGAGGCACAGTAGG - Intergenic
1043613567 8:82095754-82095776 AAGATAAGCAAAGACACAGCTGG + Intergenic
1043666967 8:82826391-82826413 AACCCAAGCAGAGGCAAGGCTGG + Intergenic
1046939849 8:119920547-119920569 ATTCTAAGCAGAGGCATGGAGGG + Intronic
1047218884 8:122902606-122902628 AAGCTCAGAAGAGGCAGAGCTGG - Intronic
1047474599 8:125214533-125214555 ATTCTAAGCAGAGGCAAAAGGGG - Intronic
1050065951 9:1759639-1759661 AATCTGAACAGAGGGAGAGCTGG - Intergenic
1054947464 9:70810759-70810781 AATCCAATTAGTGGCACAGCTGG - Intronic
1055172718 9:73279732-73279754 AATCTAAAATGAAGCACAGCAGG - Intergenic
1057453550 9:95187442-95187464 AATGTATGCAGAGGCCCAGGAGG + Intronic
1057474703 9:95388581-95388603 AATGTATGCAGAGGCCCAGGAGG - Intergenic
1058090897 9:100804284-100804306 AAGCTAGTCAGAGGCAGAGCAGG - Intergenic
1058576959 9:106414092-106414114 AAGGCAAGCAGAGTCACAGCTGG - Intergenic
1058955225 9:109940674-109940696 TATCTAGGCAGAGGGACAGCAGG + Intronic
1060236985 9:121871527-121871549 AGTCCAAGCAGGGGCAGAGCAGG - Intronic
1060795372 9:126509265-126509287 AATCTAATGAGAGGTACAGGTGG - Intergenic
1061062010 9:128255196-128255218 ATTCTCAGCCGAGGGACAGCAGG - Exonic
1062496653 9:136835014-136835036 AATTTCAGCAGAGGCCAAGCTGG + Intronic
1203426740 Un_GL000195v1:47602-47624 TATCTAATCAGGTGCACAGCTGG + Intergenic
1203439491 Un_GL000195v1:175456-175478 TATCTAATCAGGTGCACAGCTGG - Intergenic
1186546525 X:10455884-10455906 AATCTTGGCAGAGTCACACCTGG + Intronic
1187521719 X:20020156-20020178 CATCTAAGCAGAGGAACAAATGG - Intronic
1189632280 X:42967620-42967642 AATATGAGAAGAGACACAGCTGG + Intergenic
1189917769 X:45873652-45873674 AATCTTAGCAGACTCTCAGCTGG + Intergenic
1191246382 X:58231617-58231639 ATTCTAAGGATAGACACAGCTGG + Intergenic
1199988406 X:152969072-152969094 AATCTAAGCAGAAGGTCAGGGGG + Intronic