ID: 958679359

View in Genome Browser
Species Human (GRCh38)
Location 3:97306548-97306570
Sequence TCACTGGGAGGGACCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958679359_958679367 20 Left 958679359 3:97306548-97306570 CCTTGCAGGGTCCCTCCCAGTGA 0: 1
1: 0
2: 2
3: 19
4: 205
Right 958679367 3:97306591-97306613 TGTCTAGGTATCTGCTTCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 225
958679359_958679365 5 Left 958679359 3:97306548-97306570 CCTTGCAGGGTCCCTCCCAGTGA 0: 1
1: 0
2: 2
3: 19
4: 205
Right 958679365 3:97306576-97306598 AGAAACAAGAGTCCTTGTCTAGG 0: 1
1: 0
2: 4
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958679359 Original CRISPR TCACTGGGAGGGACCCTGCA AGG (reversed) Intronic
900130510 1:1085281-1085303 TGCCTGGCAGGGACCCTGCGGGG + Intronic
900590838 1:3459092-3459114 GCACTGGGTGGAACCCTGCCAGG - Intronic
900641307 1:3689251-3689273 TCTCTGGGAAGCCCCCTGCAGGG - Intronic
900646462 1:3711011-3711033 TTGGTGAGAGGGACCCTGCATGG + Intronic
901214755 1:7549100-7549122 CCTCTAAGAGGGACCCTGCAAGG - Intronic
901214801 1:7549228-7549250 CCCCTAAGAGGGACCCTGCATGG - Intronic
901534192 1:9871901-9871923 TCCCAGGGAGGGGCCCTGCTGGG - Intronic
902981562 1:20127067-20127089 TCACTGAGAGGGGCTATGCAAGG + Intergenic
903778423 1:25807585-25807607 TCGCTGGCAGGTCCCCTGCAGGG + Intronic
903994093 1:27294506-27294528 TCACTGGCAGGTGACCTGCAGGG - Exonic
907733484 1:57089655-57089677 TCACGGGGACGGATCCCGCATGG - Intronic
912417207 1:109517673-109517695 TCACTGGGGCAGATCCTGCATGG - Intergenic
916927905 1:169542301-169542323 TCACTAGGAGGGTCCTTCCAGGG + Exonic
917491325 1:175501001-175501023 TCACAGGGAGGCATCATGCAGGG - Intronic
920061115 1:203227637-203227659 ACACTCGGAGGAACACTGCAAGG + Intronic
922613989 1:226950186-226950208 ACACTGTGAGCGAACCTGCATGG - Intronic
1063595963 10:7435942-7435964 TCAGTGGGAGCTGCCCTGCAAGG - Intergenic
1069861585 10:71475076-71475098 GAACTGGAAGGCACCCTGCAGGG - Intronic
1070593365 10:77816204-77816226 ACACTGGCAGGGTCCCTGTAAGG + Intronic
1071482803 10:86077948-86077970 TCACTGGGAAGGATCCTGTGAGG + Intronic
1072127183 10:92457125-92457147 TCACTGGGATGGGCTGTGCAGGG + Intronic
1075062159 10:119264747-119264769 GCAGTGGGAGGGACCCTGGGTGG + Intronic
1075780181 10:125012340-125012362 ACACGGGGACGGTCCCTGCAGGG + Intronic
1076587617 10:131560091-131560113 AGCCTGCGAGGGACCCTGCACGG - Intergenic
1077194886 11:1274536-1274558 TCCCTGGGCGCTACCCTGCAGGG - Exonic
1077327485 11:1970002-1970024 TGACTGAGAGAGGCCCTGCAGGG - Intronic
1077504730 11:2924712-2924734 GCCCTGGGAAGCACCCTGCATGG + Intronic
1078423870 11:11233864-11233886 TCCATGGGTGGGACCTTGCATGG - Intergenic
1079145989 11:17852385-17852407 GCTCTGGGAAGGACCCAGCAAGG + Intronic
1079259038 11:18860126-18860148 TCATTGACAGGGATCCTGCATGG + Intergenic
1080687120 11:34524876-34524898 TCAGTGAGAAGGACACTGCATGG + Intergenic
1081624230 11:44638163-44638185 TAACTGGGAGGGGCCGGGCATGG + Intergenic
1083400449 11:62419565-62419587 TCACTGGAAGGGGAGCTGCAGGG + Intronic
1085448012 11:76614352-76614374 TCTCCAGCAGGGACCCTGCATGG - Intergenic
1085520501 11:77136419-77136441 CCCCTGGGGGAGACCCTGCAAGG - Intronic
1086272432 11:85083365-85083387 CCAATGGAAGGGACACTGCATGG - Intronic
1086371069 11:86156386-86156408 TCACAGGGAGGAAATCTGCAAGG - Intergenic
1087337788 11:96866179-96866201 TCTCTGGAGGGGACCCTGCAAGG - Intergenic
1087709253 11:101530537-101530559 TCACTTGGTGGGACCCTGGGTGG - Intronic
1088112477 11:106278005-106278027 CCCCTGGCAGGGTCCCTGCATGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090225838 11:125071810-125071832 GCACTGGGAGATACCCTGCTAGG - Intronic
1202810467 11_KI270721v1_random:25182-25204 TGACTGAGAGAGGCCCTGCAGGG - Intergenic
1092392334 12:8091832-8091854 TCACTTGAAGTGATCCTGCAAGG - Exonic
1092939034 12:13390455-13390477 TCTCTGGGAGGGATCCAGGAGGG - Intergenic
1096263280 12:50105860-50105882 TCACTGGAAGGGAGGCTGAAGGG + Intronic
1096487670 12:51994591-51994613 TCCCTGGGATGGACGCTGCCGGG + Intronic
1097152224 12:56987457-56987479 TCACACCGAGGGACCCTCCATGG - Intergenic
1097181622 12:57175109-57175131 TCCCTGGGAGGGACCCTGGGAGG - Intronic
1109339535 13:61038281-61038303 TTACTGGGTGGGACCATGGAAGG - Intergenic
1110244815 13:73310882-73310904 TCCCTGAGAGGTACCCTGCATGG + Intergenic
1113115618 13:106872014-106872036 TCACTGGGGAGAACACTGCAGGG + Intergenic
1113648560 13:112015961-112015983 CCACTGGGAGTAACGCTGCAAGG + Intergenic
1113648568 13:112015997-112016019 CCACTGGGAGTAACGCTGCAAGG + Intergenic
1113657731 13:112079292-112079314 GAACTGTGAGGGACCCTGCTGGG + Intergenic
1113740871 13:112711600-112711622 GGACTGGGAGGGGCACTGCAGGG + Intronic
1117799170 14:59425925-59425947 TCACTGGAAGGGGCCGGGCACGG + Intergenic
1118609919 14:67532329-67532351 TCACTGACAGAGAGCCTGCAGGG + Intronic
1119938219 14:78612945-78612967 TCACTTTGAGGAACCATGCACGG - Intronic
1124362823 15:29051327-29051349 TCACTGAGATGGACCCTGCAGGG - Intronic
1124600504 15:31129366-31129388 TCATTTGGTGGGACCCTGCAGGG + Intronic
1125412520 15:39420232-39420254 TCAGTGGCAGGGCCCCTGCCAGG + Intergenic
1129312267 15:74721110-74721132 TTAGTGGGAGGGACACGGCATGG - Intronic
1130094936 15:80848802-80848824 TCATCTGGAGTGACCCTGCAAGG - Intronic
1130551250 15:84891161-84891183 TCACACGGTGGGACCCTGGAAGG + Intronic
1131536246 15:93240235-93240257 TCACTGGGAAGGACACTGCCAGG + Intergenic
1132863911 16:2084474-2084496 TCACAGTCAGGGACCCTGGACGG + Exonic
1133131019 16:3676184-3676206 ACACTGGGACATACCCTGCATGG + Intronic
1134331223 16:13252733-13252755 TCACTGGGATGGAAGCTCCATGG + Intergenic
1135424780 16:22326973-22326995 TCACTGGGAGGGGCCCTGACGGG + Intronic
1137448567 16:48549525-48549547 ACACGGGCAGGGACCCTGCAGGG - Intronic
1138438799 16:57022143-57022165 TCACAGGGAGATACCCAGCAAGG - Intronic
1140898966 16:79350714-79350736 GGTATGGGAGGGACCCTGCAGGG + Intergenic
1142388534 16:89782821-89782843 TGACTGGCTGAGACCCTGCAGGG + Intronic
1142743073 17:1941860-1941882 TCCCTGGGAGAAACCCAGCAGGG - Intronic
1143863811 17:9909625-9909647 GACCTGGGAGGGACCCTGGAAGG - Intergenic
1144621001 17:16818523-16818545 TCGGTGGGAGGAGCCCTGCAGGG + Intergenic
1146730285 17:35187379-35187401 TCACAGGGAGAGAGCCTGCCAGG - Exonic
1147193782 17:38751887-38751909 TCAATGGGAGCGAGCCTGGACGG + Intergenic
1148203618 17:45765996-45766018 CAGCTAGGAGGGACCCTGCAGGG + Intergenic
1152185983 17:78856528-78856550 TCACTGGGAGTGACCCAGGGTGG + Intronic
1152238855 17:79151625-79151647 GCAATGGGAGGGGACCTGCAGGG + Intronic
1152912128 17:83010907-83010929 GCACTGGGATGGAGCATGCAGGG - Intronic
1153516001 18:5901839-5901861 TCACTTGGTGGGGCCCTGGAGGG - Intergenic
1159537618 18:69735491-69735513 CCACTGGGAGGGGCCTTGGAAGG - Intronic
1160444966 18:78920295-78920317 TCACTGGGAGGGAGGCTACCTGG - Intergenic
1160576264 18:79855679-79855701 TCCGTGGAGGGGACCCTGCACGG + Intergenic
1160947474 19:1650484-1650506 TCTCTGGGGAGGACTCTGCAGGG - Intronic
1161104532 19:2436845-2436867 TCCCTGTGAGGGCCCCTCCAGGG + Intronic
1161154737 19:2726776-2726798 CCACAGGGAGAGACCCTGGAGGG + Intronic
1161565212 19:4998076-4998098 TGACTGGGTGGGAGCCTGCTTGG + Intronic
1162062300 19:8103583-8103605 TGACTTGGAGGTACTCTGCAGGG + Exonic
1162374288 19:10295819-10295841 TCAAGGGGAGGGACCCTCCGGGG + Intronic
1162730621 19:12716332-12716354 AAACTGGGAGGGGCCGTGCATGG + Intronic
1163195711 19:15718095-15718117 CCACTCTGTGGGACCCTGCAAGG - Intergenic
1164946213 19:32295231-32295253 TCCCTGGGAGCCAGCCTGCAGGG + Intergenic
1165285727 19:34839842-34839864 TCCCTGGTAGTGACCCTGCCAGG + Intergenic
1168171143 19:54590475-54590497 TCCCTGGGAGAAACCCTGTATGG - Intronic
925345344 2:3168351-3168373 TCCCTGCGAGGGACCCTGTCTGG - Intergenic
927136130 2:20097762-20097784 GCACTGGGAGGGTCCCTGGCTGG - Intergenic
929246799 2:39711033-39711055 TCTCTGGGAGGGCCCTTGCATGG - Intronic
933709791 2:85316424-85316446 GGACTGGTAGGGGCCCTGCAAGG + Intergenic
934899021 2:98142289-98142311 ACCCTGGGAGGAAGCCTGCATGG - Intronic
935209988 2:100931191-100931213 ACACTGAGAGGGCCCCTGGAGGG - Intronic
935509839 2:103957905-103957927 TCACTGAAAGGGGTCCTGCAGGG - Intergenic
935808342 2:106771062-106771084 ACACCGGGAGGGACCTTGGATGG - Intergenic
936862048 2:117030138-117030160 TCACTGGGAGGGATTCAGCTGGG + Intergenic
938370066 2:130763132-130763154 CCGCTGCGAGGGTCCCTGCAGGG - Exonic
941162194 2:162048543-162048565 TGAATGAGAGGGTCCCTGCAAGG - Intronic
942505730 2:176639231-176639253 GCATTGGGAGGGACCCAGGAGGG + Intergenic
943934503 2:193898315-193898337 TCATTGGGGTGGAGCCTGCATGG + Intergenic
947160864 2:227212697-227212719 GCAATGGGAGGGACCCAGGAGGG - Intronic
947232734 2:227904104-227904126 TCAATGGGAGGGGTCCTGCTTGG + Intronic
948120170 2:235523807-235523829 CCAGTGGGAGTGACCCTGCTTGG + Intronic
948297919 2:236876485-236876507 TCACAGGGAGGAACTCTGCATGG - Intergenic
948402104 2:237692009-237692031 TAACCGGGAGGGACCCTCCGAGG + Intronic
949023643 2:241754966-241754988 GCCCTGGGTAGGACCCTGCAGGG + Intronic
1168796944 20:616932-616954 TGGCTTGGAGGGACCCTGGAGGG - Intergenic
1171204010 20:23265316-23265338 TCACAGGGAGGGACCCTGTTTGG - Intergenic
1171367637 20:24637037-24637059 TCCCTGTGGGGGATCCTGCAAGG + Intronic
1173790183 20:45823269-45823291 TCCCTGGTGGGGACCCGGCAGGG + Exonic
1174115706 20:48225042-48225064 AGAGTGGGAGGGACCCTGCCAGG + Intergenic
1174194537 20:48763738-48763760 TCAATGGGAGGAAACCTCCATGG - Intronic
1174926196 20:54762803-54762825 GCACTGAGAGGGACACAGCATGG - Intergenic
1175759928 20:61555385-61555407 TAACTGGGTGGGACCCACCAGGG + Intronic
1175844380 20:62050947-62050969 TCTGTGGGAGGGGCCCTGCCTGG - Intronic
1176024759 20:62980119-62980141 GCGTTGGGGGGGACCCTGCAGGG + Intergenic
1176071642 20:63229731-63229753 TCACTGGGAGGGTCCCAACCAGG - Intergenic
1176232201 20:64038323-64038345 TCCCTGGGTCGGACCCTGCGCGG + Intronic
1177186170 21:17799901-17799923 TTGCTAGGAGGGACCTTGCAAGG - Intronic
1179511230 21:41875147-41875169 GCAGTGAGAGGGACCCTCCAGGG - Intronic
1179929089 21:44555504-44555526 CCACTGGGTGGGACTCTGTAAGG - Intronic
1182790811 22:32951315-32951337 CCACTGAGAGGGACTCTGAATGG - Intronic
1184523591 22:45009203-45009225 TGACTGGGAGGGTGCCTGGAGGG - Intronic
1184682512 22:46079849-46079871 TCACTGCGAGGGCCCCAGCCAGG + Intronic
1185330069 22:50248526-50248548 TCACCGGGAGAGCCCCTGCCTGG + Intronic
949638091 3:6006268-6006290 TCTCTGCCAGGGACCCAGCACGG + Intergenic
949981120 3:9502207-9502229 TCACTCACAGGGACCCTGAAAGG - Exonic
950100740 3:10355205-10355227 TCACAGTGAGGGACACAGCAGGG - Intronic
951098279 3:18656827-18656849 TCAGTGGTAGGGACTCTGCTAGG + Intergenic
951724932 3:25747196-25747218 TCATTGGGCTGGGCCCTGCAGGG - Intronic
953875461 3:46664173-46664195 TGCCTGGGAGGAACCATGCATGG - Intergenic
958679359 3:97306548-97306570 TCACTGGGAGGGACCCTGCAAGG - Intronic
959589754 3:108065520-108065542 TCACTGTAAGGGGCCATGCATGG + Intronic
962255165 3:133865522-133865544 TCATTAGGACGGGCCCTGCACGG + Intronic
963107587 3:141660105-141660127 TCGCTGCGAGGGACGCTGCCTGG - Intergenic
964148432 3:153494749-153494771 TCACTGGGAGGGACACAGGGAGG + Intronic
965387610 3:168063649-168063671 TCACTGGGTGAGACCCTCAAAGG + Intronic
967933559 3:194708272-194708294 TCACCAGGAGGGACTCTGTATGG + Intergenic
967954995 3:194871259-194871281 CCCCTGGGAGGGACCCTGTGTGG - Intergenic
968415215 4:426269-426291 TCACCGGGATGGACCCTGAGGGG - Intronic
968427091 4:531369-531391 GCACTGGAAGGGAACCAGCAGGG - Intronic
968510874 4:995409-995431 GTACTGGGTGGGAGCCTGCACGG + Intronic
969373688 4:6749633-6749655 GCAGTGGGAGGGACCCTGGCAGG - Intergenic
970025725 4:11622178-11622200 TAACCGGGAGAGACCCTGGAAGG - Intergenic
970663685 4:18313352-18313374 TCACAAGCAGGGACCCTCCATGG - Intergenic
971784105 4:31078176-31078198 GCATTGGGAGGGACGCAGCAAGG + Intronic
973603667 4:52565924-52565946 TCACTGGGAGGGACTCTGGGAGG - Intergenic
976900257 4:90165751-90165773 TCACAGGGAGGAAATCTGCATGG + Intronic
978206842 4:106090004-106090026 TCCCTGGTGGGGACTCTGCAGGG + Intronic
986771494 5:10978134-10978156 TCACCAGGAGGGATCCTCCAGGG - Intronic
988997079 5:36724978-36725000 TCAGTGGGAGGGGCCCAGAACGG - Intergenic
991258978 5:64646370-64646392 TGACTGGGAGGAACCCTGAGGGG + Intergenic
999622493 5:153487232-153487254 ATAATGGGAGGGACGCTGCAGGG + Intergenic
1001278725 5:170370454-170370476 TCTTTGAGAGGGAGCCTGCAGGG - Intronic
1001615775 5:173042505-173042527 CCACTGGGGGTGTCCCTGCATGG - Intergenic
1002493506 5:179596676-179596698 GCAATGGTAGGGGCCCTGCAGGG + Exonic
1002578900 5:180195256-180195278 ACACCTTGAGGGACCCTGCAGGG + Intronic
1003806303 6:9729059-9729081 TCACTCGGGGTGTCCCTGCACGG - Intronic
1004420410 6:15464566-15464588 TCACTGGGGGGTACCCCACAAGG - Intronic
1005120428 6:22383400-22383422 TCACTGCAAGGGCACCTGCATGG + Intergenic
1006073483 6:31513955-31513977 TGGCTGGGATGGACACTGCATGG + Intergenic
1006430508 6:33993007-33993029 TTACTGGGAAGGAACCAGCAAGG - Intergenic
1006591499 6:35161245-35161267 GCCCTGGGAGGGAGCCTCCATGG + Intergenic
1006620646 6:35361609-35361631 TCACTGGGAAGTACCCTGTGGGG - Intronic
1006632053 6:35436709-35436731 CAGCTGGGATGGACCCTGCAGGG + Intergenic
1006840497 6:37025496-37025518 TCACTCGGAGGGAACCTGGAGGG + Intronic
1007299703 6:40857564-40857586 TCCCTGGGATGGAGGCTGCAGGG - Intergenic
1008425850 6:51355347-51355369 TCACTGGGAAGGACCATCTAGGG + Intergenic
1008579685 6:52895625-52895647 TCACTGGGAAGGAGCTTGCCAGG + Intronic
1008625082 6:53307577-53307599 TCACTGCCATGGACCTTGCAGGG - Intronic
1011700467 6:89950475-89950497 TCACAGAGAGGGAGGCTGCAGGG + Exonic
1013432144 6:110064681-110064703 GCACTGGGAGGGGCCCTGGGAGG - Intergenic
1015923324 6:138286960-138286982 TCACTGGGAATGACCCAGCAGGG + Intronic
1018811474 6:167301214-167301236 ACACTGGGGGTAACCCTGCAGGG - Intronic
1019015959 6:168879284-168879306 GCCCTGGTAGGGAACCTGCAGGG - Intergenic
1020096993 7:5374773-5374795 TGACTGTGAGGGTCCGTGCAGGG - Intronic
1021092922 7:16504205-16504227 TCACTGGGTAGGTCACTGCAAGG + Intronic
1021517310 7:21502822-21502844 TCACAGGGAAAGACCCTGTAGGG - Intronic
1021612940 7:22475656-22475678 TCCCTGAGAATGACCCTGCATGG + Intronic
1024002079 7:45196698-45196720 TCAGAGGAAGGGAACCTGCATGG - Intergenic
1024005342 7:45221458-45221480 TCACCGAGAAGGGCCCTGCAGGG + Intergenic
1024758420 7:52564242-52564264 ACACTGGGAGGGACCCAGAAAGG + Intergenic
1028917362 7:96274144-96274166 TGACTGGGAGGGAGCAGGCAGGG - Intronic
1030196543 7:106858814-106858836 TCACTGAGACACACCCTGCAAGG + Intergenic
1030627594 7:111860675-111860697 GCACTGGCACAGACCCTGCAGGG + Intronic
1031622093 7:123946417-123946439 CCAATGGAAGGGACTCTGCATGG - Intronic
1032161864 7:129517073-129517095 TCATGGGGATGGATCCTGCATGG - Intergenic
1034840094 7:154387583-154387605 TAAATGGTAGGGACCCTACATGG - Intronic
1035222897 7:157417053-157417075 TCACTGGGAGGGAGCATGCAGGG - Exonic
1036704259 8:11034863-11034885 TCACTGTGAGGGAACAGGCAAGG - Intronic
1042507440 8:69575962-69575984 TGACTTGCAGGGACCCTGAAAGG - Exonic
1046861702 8:119100183-119100205 TCACTGGGAAGCACCATGAAAGG + Intronic
1047260603 8:123255897-123255919 TCACTGGCAAGGACCATGCAAGG + Exonic
1048251486 8:132869847-132869869 TCCCTTGGAGGGACCCTGCTAGG + Intronic
1049230264 8:141478201-141478223 TCACTGTGAGGGGCCCCGCAGGG - Intergenic
1049399197 8:142417338-142417360 TCCCTGAGAGGGACCCAGCTAGG - Intergenic
1049463221 8:142739619-142739641 TCCCTGGGAGGGCACCTGCGAGG - Intergenic
1057481277 9:95447330-95447352 TCTCTGGGGGGGTCCCTGCGGGG + Exonic
1057553003 9:96065792-96065814 TTGCTGGCAGGGACTCTGCAGGG - Intergenic
1057864193 9:98666344-98666366 TCACTGGGAGTGATCCTGAGTGG - Intronic
1061809487 9:133154093-133154115 CCAGTGGGAGTGACCCTGGATGG + Exonic
1061871028 9:133520633-133520655 TCTCCGGGAGGGACCCTACACGG + Intronic
1061940506 9:133881329-133881351 TCACTGGGAGGAACCTTGTGGGG - Intronic
1185633806 X:1536840-1536862 TCGCTGGGAGGGTCCGTGTACGG - Intronic
1190144819 X:47880910-47880932 TCATTGGTGGGGACTCTGCAGGG + Intronic
1190426682 X:50339869-50339891 TCATGGGGATGGAGCCTGCATGG - Intronic
1196116571 X:112005654-112005676 GAACTGGGAGTGACCCTGCTGGG + Intronic
1199595403 X:149502964-149502986 TTACTGACAGGTACCCTGCAGGG + Intronic
1199598476 X:149526249-149526271 TTACTGACAGGTACCCTGCAGGG - Intronic
1199786679 X:151112366-151112388 TCCCTGGGAGGCACCCTGGTTGG + Intergenic
1200162932 X:154018565-154018587 ACCCTGGCAGGGACCCTGGAAGG - Intronic
1201244859 Y:11993733-11993755 TAACTGGGAGGTACCCAGCAGGG - Intergenic
1202160346 Y:21927817-21927839 TCCCTGCAGGGGACCCTGCAGGG + Intergenic
1202231010 Y:22658561-22658583 TCCCTGCAGGGGACCCTGCAGGG - Intergenic
1202312148 Y:23537604-23537626 TCCCTGCAGGGGACCCTGCAGGG + Intergenic
1202558655 Y:26132990-26133012 TCCCTGCAGGGGACCCTGCAGGG - Intergenic