ID: 958681661

View in Genome Browser
Species Human (GRCh38)
Location 3:97339721-97339743
Sequence GTGTCGTTTATTTTACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958681661_958681664 15 Left 958681661 3:97339721-97339743 CCAAGCAGTAAAATAAACGACAC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 958681664 3:97339759-97339781 AGAAGTTTGCAGTAGCTCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 150
958681661_958681663 14 Left 958681661 3:97339721-97339743 CCAAGCAGTAAAATAAACGACAC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 958681663 3:97339758-97339780 TAGAAGTTTGCAGTAGCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958681661 Original CRISPR GTGTCGTTTATTTTACTGCT TGG (reversed) Intronic
903627029 1:24738234-24738256 GTATCCTTTATTTAAATGCTTGG + Intergenic
906913164 1:49978436-49978458 TTGTTGTTTATTTTAGTGATAGG - Intronic
912904789 1:113692901-113692923 GTGTAGTTTTTTTTTCTGTTAGG - Intergenic
915258568 1:154656645-154656667 CTTTAGTTTATTTTACTTCTTGG + Intergenic
915741011 1:158118365-158118387 GTGTAATTTATTTTCCTGCATGG - Intergenic
915812617 1:158930755-158930777 GTGTCGTTTATTTGACATCTTGG + Intergenic
916901734 1:169232017-169232039 ATGTCATTTATTTAATTGCTGGG - Intronic
917649183 1:177059866-177059888 GTGTAGATTATTTCACTGTTAGG - Intronic
917884708 1:179372176-179372198 CTGTTTTATATTTTACTGCTGGG - Intronic
920712734 1:208310524-208310546 GTGTATTATATTTTACTCCTTGG + Intergenic
921473642 1:215579005-215579027 GTGTTGTTTATTTTACGACTAGG - Exonic
923465738 1:234246719-234246741 GTGTGGTTTTTATTAATGCTAGG - Intronic
1069345575 10:67465696-67465718 TTGTTGTTTATTTTTCTGATAGG - Intronic
1071223680 10:83500231-83500253 GTATCTTTTATTTTACCCCTTGG + Intergenic
1073850821 10:107616200-107616222 GTGTTGTTGAATTTACTACTAGG + Intergenic
1075316945 10:121460419-121460441 GTGTCGTTTATTTTTAGGCCTGG + Intergenic
1076852398 10:133099488-133099510 GTGTCGTTCTTTTCAATGCTCGG - Intronic
1079390200 11:20015587-20015609 TTGTTTTTTATTTGACTGCTTGG + Intronic
1079529131 11:21427867-21427889 GTGGCTTTTATTTTTCTGCAAGG - Intronic
1079722852 11:23841137-23841159 TTGTCGTTTATTATAGTACTGGG - Intergenic
1080068039 11:28042977-28042999 GTGTCTTTTACTTAACTCCTTGG - Intronic
1081780971 11:45712512-45712534 GGGTAGTTTATTTTACTGTAGGG - Intergenic
1083693633 11:64427643-64427665 TTGTCCTTTATTTTACTGAAAGG + Intergenic
1087729643 11:101764019-101764041 GTGTCATCTATTTTTCTGCCAGG - Intronic
1088367032 11:109050694-109050716 GTGTGGTTTATTTTCCTGAATGG - Intergenic
1089747928 11:120629975-120629997 GTGCCTTTTATTTTGGTGCTGGG - Intronic
1089756821 11:120693430-120693452 GTTTCCTTCATCTTACTGCTGGG - Intronic
1089997080 11:122918640-122918662 GTGTGGTTTATTTTAAAGCCAGG - Intronic
1093196988 12:16141369-16141391 CTTTTGTTTATTTTCCTGCTAGG + Intergenic
1093345218 12:18033423-18033445 GTATGGTTCACTTTACTGCTGGG + Intergenic
1093960962 12:25272328-25272350 GGGTCTTTTATTTTGCTGGTAGG - Intergenic
1095358000 12:41299430-41299452 GTGTAGTTTATTTTAATTATTGG + Intronic
1095731787 12:45513452-45513474 GTGTGGTTAATTTTACATCTTGG + Intergenic
1096152292 12:49322347-49322369 GTGTCTTTCATTTTACGGGTAGG - Intergenic
1096779328 12:53983130-53983152 GTCTCCTTTATTTTCCTGCCTGG - Intergenic
1099643669 12:85322873-85322895 ATGTGGTTTGTTTTAGTGCTGGG - Intergenic
1100993668 12:100279065-100279087 GTGTGGTTTATTTAATTTCTTGG + Intronic
1102906183 12:116676871-116676893 GTGTCGTTAAGTTTTCTCCTTGG - Intergenic
1104110259 12:125698005-125698027 GTGTCCTTTATTTTACAGGAGGG + Intergenic
1108713681 13:53058344-53058366 GAGTATTTTATTTTTCTGCTGGG - Intergenic
1111742862 13:92226535-92226557 GTGTTTTTCATTTTACTTCTTGG - Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1113458554 13:110465892-110465914 GTGTCGTATATGTTGCTGGTGGG - Intronic
1113867317 13:113535613-113535635 GTGCCGGTGGTTTTACTGCTGGG - Intronic
1119150543 14:72355676-72355698 GTGTATTTTATTTTTCTCCTTGG - Intronic
1120246215 14:82010461-82010483 GTTTTGATTATTTGACTGCTAGG + Intergenic
1126430932 15:48583520-48583542 GTTCAGTTTATTTTACTGATGGG + Intronic
1127192936 15:56551322-56551344 GTTTATTTTATTTTATTGCTGGG + Intergenic
1136221075 16:28829350-28829372 TTGTCGTTGCTTTTCCTGCTGGG + Intronic
1140656571 16:77146951-77146973 GTGTTGTTTATTTTATTCCTGGG - Intergenic
1142722202 17:1783994-1784016 GTGTCATTTATTTTAATTCCAGG - Intronic
1143487339 17:7262084-7262106 GTGTCGTTTGTTTTACTGTAGGG - Exonic
1145414807 17:22705781-22705803 GTGTCAGTAGTTTTACTGCTTGG + Intergenic
1148247621 17:46045081-46045103 GTGTGGTAGATTTTACTACTGGG - Intronic
1149019613 17:51948118-51948140 GTGAAATTTCTTTTACTGCTGGG + Intronic
1153079151 18:1200541-1200563 GTGTCTTTTGTTTTATTTCTAGG + Intergenic
1153787450 18:8547312-8547334 GTGTCTTTTAATTTCCTGGTTGG + Intergenic
1160137506 18:76285133-76285155 GTGTTGTTTATATTATTTCTGGG + Intergenic
1162911628 19:13850824-13850846 GTGTCGCTTCTTTTACTGACGGG - Intergenic
1164026045 19:21354041-21354063 TTGTGATTTATTTTTCTGCTGGG + Intergenic
1164077399 19:21833184-21833206 GTGTCTTTTATTTTATGGCTGGG - Intronic
1164446904 19:28325539-28325561 GTATTGGTTATTTTCCTGCTTGG - Intergenic
925501163 2:4506685-4506707 GTGTCTTTTATTTTTCTGATTGG + Intergenic
925706751 2:6692182-6692204 GTGTAGTTTATGTTACTCATGGG - Intergenic
925939817 2:8806244-8806266 GTATCTTATATTTTAATGCTTGG - Intronic
927046719 2:19286458-19286480 GTGTCCATTTTTTTACTGATCGG - Intergenic
929261989 2:39876110-39876132 ATGTTGTGTATTTTAGTGCTAGG + Intergenic
929728103 2:44454407-44454429 ATTTAGTTTATTTTACTGGTAGG - Intronic
931240871 2:60451392-60451414 GTTTGGTATTTTTTACTGCTTGG - Intronic
933261081 2:80132110-80132132 GTGCAGTTTAATTTTCTGCTTGG + Intronic
934879650 2:97964810-97964832 GTGTGTATTAATTTACTGCTTGG - Intronic
936699360 2:114992141-114992163 GTGCCCTTTATTTTACTCATAGG + Intronic
936699486 2:114993716-114993738 GTGCCCTTTATTTTACTCATAGG + Intronic
938746465 2:134283024-134283046 CTGTCATTTATGTTTCTGCTAGG + Intronic
939790830 2:146572804-146572826 TTGTGGTTTATTTCATTGCTGGG - Intergenic
941474266 2:165929285-165929307 TTGTCGTTTATTTTTCTTCATGG + Exonic
942259884 2:174148759-174148781 ATGTTGTCTATTTTACTGCTGGG - Intronic
942432588 2:175929300-175929322 ATGTCTTTTATTTTACAACTGGG - Exonic
943004964 2:182377764-182377786 GTGTGGTTTATTTTCATGTTGGG - Intronic
945478657 2:210318280-210318302 TTGTCGTTTGTTTTAGTTCTTGG - Intergenic
946600733 2:221357279-221357301 GTGTTGTATATTTTATTGATTGG - Intergenic
1169633256 20:7657638-7657660 TTGTCATATATTTTATTGCTTGG + Intergenic
1175292870 20:57889952-57889974 GTGTGGTTTATTCTTGTGCTTGG + Intergenic
1175678363 20:60966343-60966365 GTGACCTTTATATTACAGCTAGG + Intergenic
1175859110 20:62140444-62140466 GTGTGGTCCTTTTTACTGCTGGG + Intronic
956322906 3:68018530-68018552 GTGTCATTTCTATTACTACTGGG - Intronic
958681661 3:97339721-97339743 GTGTCGTTTATTTTACTGCTTGG - Intronic
960773274 3:121217866-121217888 ATGACGTCTATTTTATTGCTTGG + Intronic
961929913 3:130522472-130522494 GGGCCCTTTATTTTCCTGCTGGG + Intergenic
963548454 3:146691968-146691990 TTGTAATTTATTTTACTTCTGGG + Intergenic
967376366 3:188807885-188807907 GTGTTGTTATTTTTACTTCTTGG + Intronic
969504807 4:7578762-7578784 GTGTGTTTTATTTTACAGATGGG - Intronic
974336772 4:60558015-60558037 GTGTTTTTTATTTAACTGATTGG - Intergenic
975238256 4:72026382-72026404 GTGTGCTGTATTCTACTGCTAGG + Intergenic
982239926 4:153289612-153289634 ATCTCGTTTCTTATACTGCTGGG + Intronic
982888413 4:160814553-160814575 GTTTCGTTTATTTATATGCTAGG + Intergenic
983497294 4:168458055-168458077 GTGTCTCATATTTTACAGCTGGG - Intronic
984377401 4:178949687-178949709 GTGTAATGTATTTTAGTGCTAGG - Intergenic
992105456 5:73446980-73447002 GTGTCGAGAACTTTACTGCTAGG - Exonic
995353377 5:111208769-111208791 GTGTTCTTTAATTTTCTGCTGGG + Intergenic
995743349 5:115377719-115377741 GTTACTTTCATTTTACTGCTGGG - Intergenic
997096255 5:130916134-130916156 GTGTCCTTTATTCTATTGATGGG - Intergenic
997617147 5:135255223-135255245 GTCTGGTTTGTTTTACTGTTAGG - Intronic
997849362 5:137317084-137317106 TGGTCCTTGATTTTACTGCTTGG + Intronic
999907656 5:156161222-156161244 CTGTCGTCTATTTTACTTTTGGG + Intronic
1010633971 6:78233808-78233830 GTGTGCTTTATTTTTCTGCTAGG - Intergenic
1011167678 6:84467846-84467868 GTGTTGTTTGTTTTACCACTGGG + Intergenic
1011613827 6:89179972-89179994 TTGTCATTTATTTTTCTCCTGGG + Intronic
1012271758 6:97221425-97221447 GAGTAGTTTATATTACTGCATGG + Intronic
1019861954 7:3667058-3667080 TTGTCATTTATTTTTCTTCTAGG - Intronic
1023489652 7:40725273-40725295 GAGTCCTCTATATTACTGCTTGG - Intronic
1026103735 7:67404089-67404111 CTCTAGTTTATTTTCCTGCTGGG + Intergenic
1027623729 7:80523453-80523475 GTTTCATTTATTTTACTGGATGG + Intronic
1028096438 7:86766796-86766818 GTATAGTTTCTTTTAGTGCTTGG - Intronic
1029927299 7:104330393-104330415 TTGTCGTTTATTCTATTCCTGGG + Intronic
1033910897 7:146262017-146262039 GTTTCTTTTATTGTTCTGCTTGG + Intronic
1034356666 7:150455905-150455927 GTGCCTTTTATCTTTCTGCTTGG + Intronic
1034717939 7:153260955-153260977 GAGTGGTTTATTTTTCTGTTTGG - Intergenic
1036969476 8:13338951-13338973 GTGTGTTTTATTTAATTGCTTGG - Intronic
1040444855 8:47483177-47483199 GTGTCTTTTATTTTACGCTTGGG + Intronic
1043775943 8:84268527-84268549 GTGTAGTTTATTGTATTACTTGG + Intronic
1046395658 8:113634925-113634947 GGGACATTTAATTTACTGCTGGG + Intergenic
1046592429 8:116222325-116222347 GTGTCTTATCTTTTACAGCTGGG - Intergenic
1051805037 9:20983019-20983041 GTGTCATTTATTTTACTTTATGG + Intronic
1055704763 9:78985693-78985715 GTTTCATTTATTTTACTGCCAGG + Intergenic
1057323075 9:94032035-94032057 GTGTCGTTTCATTTACTGTGTGG + Intronic
1057623866 9:96660524-96660546 GTGTGGTTTTTTTGACTGGTGGG + Intergenic
1058970836 9:110081528-110081550 GTGGTGTTTTGTTTACTGCTTGG + Intronic
1061185108 9:129048453-129048475 GTGTCGTTGCTCTTGCTGCTGGG - Exonic
1186213252 X:7272621-7272643 CTGTCGTTCACTTGACTGCTGGG + Intronic
1187487361 X:19717080-19717102 GTGTCTTTCATTCTTCTGCTGGG - Intronic
1189061465 X:37757765-37757787 GTGTGTTTTATTTTCCTCCTGGG - Intronic
1190058598 X:47196565-47196587 GTGTAGATTGTTTTTCTGCTGGG + Intronic
1190983979 X:55484072-55484094 CTGTAGTTTATTTTTCTGCTCGG - Intergenic
1193745109 X:85268383-85268405 CTTTATTTTATTTTACTGCTTGG + Intronic
1194213068 X:91092585-91092607 GTGTTGTTTGTTTGACTCCTGGG + Intergenic
1194511652 X:94803561-94803583 TGGTAGTTTATTTTTCTGCTAGG - Intergenic
1196693493 X:118585827-118585849 GTGTCTTCTATTTTTCTCCTGGG - Intronic
1201013060 Y:9568829-9568851 GCGAAGTTTATTTTACTGCAAGG + Intergenic
1201262802 Y:12176901-12176923 GTTTCATTTATTTTAGTGATTGG - Intergenic