ID: 958689106

View in Genome Browser
Species Human (GRCh38)
Location 3:97438834-97438856
Sequence CAAGCTTGACCCTTTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958689104_958689106 19 Left 958689104 3:97438792-97438814 CCTGTAAAACAGTTTTACATATT 0: 1
1: 0
2: 3
3: 42
4: 410
Right 958689106 3:97438834-97438856 CAAGCTTGACCCTTTGATATAGG 0: 1
1: 0
2: 0
3: 6
4: 68
958689103_958689106 29 Left 958689103 3:97438782-97438804 CCTGCTGGATCCTGTAAAACAGT 0: 1
1: 0
2: 0
3: 9
4: 140
Right 958689106 3:97438834-97438856 CAAGCTTGACCCTTTGATATAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958689106 Original CRISPR CAAGCTTGACCCTTTGATAT AGG Intronic
907041992 1:51269547-51269569 CAAGCTTGGTCCTATGAAATGGG + Intronic
908492701 1:64662311-64662333 CAAGCATTAGCCTTTGAAATAGG + Intronic
915704548 1:157831694-157831716 CAACCCTGACCCTTTGACACTGG - Exonic
920130435 1:203727842-203727864 GAAGCTTGCCCATTTGATAGAGG - Intronic
1069770986 10:70899797-70899819 CAAGGTTGTCCTTTTGTTATTGG + Intergenic
1072270003 10:93767044-93767066 AAAGGTTGACCCTTTGAGAGGGG - Intronic
1072650568 10:97292052-97292074 CAATCTTGACACTTGGAAATAGG + Intronic
1082160985 11:48887546-48887568 CAATATACACCCTTTGATATCGG + Intergenic
1082161381 11:48892860-48892882 CAATATACACCCTTTGATATCGG - Intergenic
1082240055 11:49859817-49859839 CAATATACACCCTTTGATATCGG + Intergenic
1082656592 11:55865316-55865338 CAATATACACCCTTTGATATTGG - Intergenic
1089043070 11:115472207-115472229 CTAGGATGACCTTTTGATATTGG - Intronic
1094191256 12:27700659-27700681 TAAGCTTGACTCTATGCTATTGG - Intergenic
1094404782 12:30105929-30105951 CAAGCTTGTACCTCTGATTTAGG - Intergenic
1094415982 12:30215581-30215603 CAAACTTGAGCCTTTGAGATTGG + Intergenic
1095611831 12:44137868-44137890 CATGCTTTACCCTGTGACATTGG + Intronic
1101561381 12:105861021-105861043 CAGGCTTCACCCTGTGAGATTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104266138 12:127234573-127234595 CAATATTGAACCTTTAATATAGG - Intergenic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1114907151 14:27144246-27144268 CAAGCTGGTCGCTCTGATATGGG - Intergenic
1126301692 15:47203704-47203726 CAACCTTGACCCTTTATGATAGG + Intronic
1129207857 15:74047907-74047929 CATGGTTGACCCCTTGATCTTGG - Intergenic
1138862811 16:60778616-60778638 CAAACTTGACCCTTTTATCTTGG + Intergenic
1144660454 17:17064643-17064665 CAACCTGGAACCTTTGAGATTGG + Intronic
1147239336 17:39080325-39080347 AAAGATTGAGCCTTTGGTATGGG + Intronic
1147891649 17:43721501-43721523 CAAGGTTCACCTTTTGATCTTGG + Intergenic
1150625265 17:66837192-66837214 CCAGCTTGACTCTCTGACATTGG + Intronic
1153318440 18:3748266-3748288 CAAGCTTGACCCTTTGTATCCGG + Intronic
1153782458 18:8506340-8506362 CAAGACTGACCCTGTGATAGTGG - Intergenic
1157769937 18:50337152-50337174 CAAGCTTGACCACTAGAAATAGG - Intergenic
1158862953 18:61610882-61610904 AAAGGATGACCCTTTGAAATGGG + Intergenic
1164768197 19:30787802-30787824 TAAATTTGACCCTTTGATAGTGG + Intergenic
1165622096 19:37256766-37256788 CAAGCTTGAACATTTGATGGTGG + Intergenic
1165633709 19:37322984-37323006 CAAGCTTGAACATTTGATGGTGG + Intronic
931284047 2:60817888-60817910 CAAGGATGGCCCTTTGAAATTGG - Intergenic
931853544 2:66278147-66278169 CAAGCTTGACCAATTGCTAGAGG + Intergenic
936006626 2:108894705-108894727 CAAGCTTTAGCCTATGTTATGGG - Exonic
938967246 2:136399403-136399425 TAAGCTTGACCCTTGGAGCTGGG + Intergenic
941927109 2:170906888-170906910 CAAGGAGGACCCTTTGAGATTGG + Intergenic
944386907 2:199176102-199176124 CTAGCTTGACTCTCTGATAGTGG + Intergenic
1170309256 20:14974931-14974953 CAAGCTAGACCCTTGGATAATGG + Intronic
1172666448 20:36603852-36603874 TAAGCTTTACCATTTCATATGGG + Intronic
1175532519 20:59683914-59683936 CCAGCTTGACCCTCTGCTAGAGG + Intronic
953589847 3:44241459-44241481 CAAGCTTGCTCCTTTCACATAGG - Intergenic
954301352 3:49702322-49702344 GAAGCTTCACCCTTTGAGAGAGG - Exonic
958443227 3:94181555-94181577 CAAGATTGTGCCTTTCATATGGG + Intergenic
958689106 3:97438834-97438856 CAAGCTTGACCCTTTGATATAGG + Intronic
962081911 3:132148997-132149019 CAAGGTTGACCCTGTGTTATTGG + Intronic
962473986 3:135739862-135739884 TAACCTTGACCCTTTCACATTGG - Intergenic
965462017 3:168977692-168977714 CATGCTTGCCCCTTTCAAATAGG + Intergenic
966481809 3:180417948-180417970 CAAGCTTGCCCCTTTTGTAATGG + Intergenic
971449260 4:26784895-26784917 CAACATTCACCCTTTGATACTGG - Intergenic
971626753 4:28930781-28930803 CAAGCTGGATCCTTGGAAATAGG - Intergenic
972106264 4:35492966-35492988 CAAGCTAGAACCTGTGAAATGGG + Intergenic
976514766 4:85952671-85952693 CAAGTTTGATACTTTTATATAGG + Intronic
983737144 4:171075634-171075656 CTACCTTGACCCTCTGATTTAGG + Intergenic
983760416 4:171398739-171398761 AAATCTTTACCCTTTGATAGGGG - Intergenic
984071456 4:175118695-175118717 AAAGCTTTACTCTTTGATACAGG - Intergenic
994800555 5:104368725-104368747 CATGCTTCTCCCTTTCATATTGG - Intergenic
998720528 5:144942487-144942509 CAAGCTTTGCCCTGTGTTATAGG + Intergenic
999150073 5:149421028-149421050 CAAGCCTGTCCCTTTGGTCTTGG + Intergenic
1002715009 5:181221694-181221716 CATGCATGACCCTTTGCTGTAGG - Intergenic
1006947267 6:37793027-37793049 CAGGCTTAACCCTTTGGGATTGG - Intergenic
1007630748 6:43271988-43272010 CAAGGTGGACCCTTTGAGAAGGG + Intronic
1014361155 6:120476153-120476175 CAATATTAAGCCTTTGATATGGG + Intergenic
1017721143 6:157244004-157244026 CAAGCTGCACCCTTTGTTACAGG + Intergenic
1020765949 7:12321250-12321272 ATGGCTTGACTCTTTGATATGGG + Intergenic
1031975921 7:128093475-128093497 TAAAATTGACCCTTTGATCTTGG + Intergenic
1046422054 8:113999464-113999486 TAAGCTTGCCTCTTTCATATTGG - Intergenic
1050612082 9:7363363-7363385 CAAGGGTGACACTTTTATATGGG - Intergenic
1055198399 9:73625667-73625689 CAAGGTGGGCCCTTTTATATTGG + Intergenic
1061637824 9:131925879-131925901 CAGGCATGGCCCTTTCATATTGG - Intronic
1186841568 X:13489516-13489538 CAACTATGACCCTTTGATAATGG - Intergenic
1197011963 X:121575162-121575184 CAAGCTAGAACATTTGAGATAGG + Intergenic