ID: 958691055

View in Genome Browser
Species Human (GRCh38)
Location 3:97466782-97466804
Sequence CAATATGCACAAGAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958691055_958691058 -9 Left 958691055 3:97466782-97466804 CCAACTTCCTCTTGTGCATATTG 0: 1
1: 0
2: 1
3: 16
4: 233
Right 958691058 3:97466796-97466818 TGCATATTGGTATGTGTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958691055 Original CRISPR CAATATGCACAAGAGGAAGT TGG (reversed) Intronic
900584793 1:3427608-3427630 CAATAAACACAGGAGGCAGTTGG + Intronic
906830248 1:49023450-49023472 GAATAGGCCCAAGAGTAAGTTGG + Intronic
909727339 1:78851296-78851318 CACCATGCACAAGACGAAGCAGG - Intergenic
911087194 1:93988993-93989015 CAAAAAGCAAAAGAGGAAGGGGG - Intergenic
911270941 1:95800256-95800278 AAATGCCCACAAGAGGAAGTGGG + Intergenic
911834521 1:102599421-102599443 CAATATGCATCAGAGGGTGTTGG + Intergenic
912300970 1:108516879-108516901 AAATACCCACAAGAGAAAGTAGG - Intergenic
915999290 1:160599236-160599258 TATTATGCAGAAGAGGAATTAGG + Intergenic
918155962 1:181846992-181847014 CTTTGTGCACAAGAAGAAGTTGG - Intergenic
919067979 1:192716452-192716474 GAATAAGCACAAGAGAAAGAAGG + Intergenic
919523839 1:198622590-198622612 TAATATGCAGAAGAAGAATTTGG - Intergenic
920288087 1:204896107-204896129 CAATCTGGAGGAGAGGAAGTGGG + Intronic
923056454 1:230429668-230429690 AAATATGAAAAAAAGGAAGTGGG + Intergenic
1063140573 10:3253160-3253182 CAATATACAAGAGAGGAAGGGGG - Intergenic
1063168741 10:3487014-3487036 CAATTTGCAGAAGAGGAGATTGG + Intergenic
1065043510 10:21722659-21722681 GAAGATGCAGAAGAGGAAGACGG - Intronic
1065491654 10:26288415-26288437 CAATTTTCAAAAGAGGAAGGGGG - Intronic
1065865211 10:29909117-29909139 CATTTTGCACAGGAGGAAATGGG - Intergenic
1066618933 10:37323954-37323976 CAAAAAGCAAAAGAGAAAGTAGG + Intronic
1066756689 10:38718998-38719020 GAAGATGATCAAGAGGAAGTTGG + Intergenic
1067326174 10:45268827-45268849 AAATACCCACAAGAGAAAGTAGG + Intergenic
1068202352 10:53798191-53798213 CAAAATGAACAAGAGGATATGGG + Intergenic
1069005519 10:63313721-63313743 GAATATGCACAAGTGGCAGATGG - Intronic
1069029646 10:63582039-63582061 CAATATCAACTAGAGGAAGGTGG - Intronic
1069067959 10:63964457-63964479 CACTAAGCACATGAGGAAATAGG - Intergenic
1070393572 10:75992123-75992145 CATTATGCACATGAGGAAAAAGG + Intronic
1071727316 10:88212313-88212335 CACCTTGCACAAGATGAAGTAGG - Intergenic
1072167543 10:92828755-92828777 CAAAATGCACAAGAAGTAGTGGG + Intergenic
1073989453 10:109245868-109245890 CCATAGGCCCAAGAGGAAGTGGG + Intergenic
1074647254 10:115472045-115472067 CAATATGCAGAAGATGAAATTGG - Intronic
1076516467 10:131047773-131047795 CATTATGCACAAGAAGAAGGCGG - Intergenic
1077550054 11:3196246-3196268 AAGTCTGCACAAGAGAAAGTGGG + Intergenic
1078845779 11:15117312-15117334 TAATATGCAGGAGAGCAAGTTGG + Intronic
1078987413 11:16609220-16609242 CAGTATGCACAAGGTGAGGTTGG + Intronic
1079570253 11:21934410-21934432 GAATAAACAAAAGAGGAAGTTGG - Intergenic
1080905669 11:36542504-36542526 CAAGATGCCCAAGAGGAAGAGGG + Intronic
1081341067 11:41928446-41928468 CAATATGGACAAGATCAGGTGGG - Intergenic
1082951733 11:58823499-58823521 AAATATACACATAAGGAAGTGGG - Intergenic
1082967914 11:58987032-58987054 AAATGTCCACAAGAGAAAGTAGG - Intronic
1083739092 11:64698471-64698493 CATTTTGCAGAAGAGGCAGTAGG - Intronic
1083852660 11:65377134-65377156 TTATATTCACAAGAGGAAGGAGG + Intronic
1085628236 11:78090091-78090113 CCACATGCAAAAGATGAAGTTGG - Intergenic
1085946067 11:81275128-81275150 AAATATGCACTTGTGGAAGTTGG - Intergenic
1086802774 11:91197637-91197659 CAGAATGCACAAGAGGAAAGTGG - Intergenic
1087662238 11:101001152-101001174 CAATTTACACAAGGGGAATTAGG - Intergenic
1088169892 11:106984034-106984056 TAAAAGGCAAAAGAGGAAGTTGG + Intronic
1089049941 11:115537361-115537383 CCAGATCCACCAGAGGAAGTTGG - Intergenic
1089567001 11:119377184-119377206 CCATTTGCAGATGAGGAAGTTGG + Intronic
1089856991 11:121554419-121554441 AAAGATGCTCAAGAGGCAGTTGG - Intronic
1090454521 11:126836613-126836635 TCATATGCACAACAGAAAGTTGG - Intronic
1090836223 11:130455959-130455981 CGATATGCACCAGAGGCAGCAGG + Intronic
1090901671 11:131037689-131037711 CAGTATCCACAAGAGGTAATAGG - Intergenic
1092882730 12:12900542-12900564 GAATAAGAACAAGAGGAAGAGGG - Intronic
1093380442 12:18484960-18484982 CAAAATATACAAGATGAAGTGGG + Intronic
1096915642 12:55029312-55029334 CAATCTGCCCTAGAGGAAATAGG + Exonic
1099540463 12:83901811-83901833 AAATGTCCACAAGAGGAAGGAGG + Intergenic
1102721218 12:115018016-115018038 CAACATGAACAAGAGGAAGAAGG - Intergenic
1107803482 13:44132236-44132258 CAAAATGCACTAGAAGAAGGTGG + Intergenic
1108237772 13:48426976-48426998 CAATAGGAGCAAGAGGAAGGAGG + Intronic
1110488129 13:76070291-76070313 CATTTTGCACAGGAGGGAGTGGG - Intergenic
1110703689 13:78579868-78579890 CAAAAAGCAGAAAAGGAAGTGGG + Intergenic
1114801606 14:25781974-25781996 AAATGTGCACAAGAGAAAGCAGG - Intergenic
1118433824 14:65750927-65750949 CCATATCCACAACAGGAAATAGG + Intergenic
1118995638 14:70833232-70833254 CACTAAGCAAAAGAGGAAGAGGG - Intergenic
1122823810 14:104360060-104360082 CAACATGGACAACAGGAATTTGG - Intergenic
1126051176 15:44686435-44686457 AAATGCCCACAAGAGGAAGTAGG + Intronic
1128246830 15:66138724-66138746 CATTTTGCAGAAGAGGAAGCTGG - Intronic
1128831309 15:70771908-70771930 GAATATGGGCAAGAGGAGGTTGG + Intergenic
1130846777 15:87755021-87755043 CAAGATGAACAAGATGAACTAGG - Intergenic
1133648146 16:7783821-7783843 CAGCATGCACCAGAGTAAGTTGG - Intergenic
1134112369 16:11523664-11523686 CAAGATGAACAAGAGCAAATTGG - Intergenic
1137387316 16:48053725-48053747 CAATAAGCATTAGAGGAAATGGG - Intergenic
1138646275 16:58427365-58427387 CAATCTGCAAAAGAGAAAGAAGG - Intergenic
1138884245 16:61055624-61055646 GAATAAGCACAAGAGAAAGAAGG - Intergenic
1139615838 16:68090714-68090736 CAGTATGAAAAGGAGGAAGTTGG + Intronic
1141332592 16:83125662-83125684 TCATATGCAAAAGAGGAAATTGG + Intronic
1143152204 17:4814690-4814712 CATTATGCTCAAGAGGAAGGCGG + Exonic
1143912082 17:10259031-10259053 GAATAAGCACAAGAGAAAGAAGG + Intergenic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1148000080 17:44382757-44382779 GAGCATGCACAGGAGGAAGTGGG - Intronic
1150887198 17:69100787-69100809 CAATACTTACAAGAGGAAATGGG + Exonic
1153778448 18:8473983-8474005 CAATAAGGACAGAAGGAAGTGGG - Intergenic
1155207223 18:23570712-23570734 AAATATGCAAAAGAGCAAGCTGG - Intronic
1161987726 19:7666279-7666301 GAATAAGCACAAGAGAAAGAAGG + Intergenic
1162872619 19:13598005-13598027 CCATTTGCAGGAGAGGAAGTGGG - Intronic
1163047209 19:14652413-14652435 TAATATGCACAAAAGGAAATAGG - Intronic
1164040749 19:21490681-21490703 CAATATGTGCAAGAGGAACCAGG - Intronic
1165043688 19:33087215-33087237 AAAAGTTCACAAGAGGAAGTAGG - Intronic
1165064482 19:33221037-33221059 CACTATGGAGAAGAGGCAGTGGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166232458 19:41433196-41433218 CCAGATGCAGGAGAGGAAGTGGG - Intronic
925513132 2:4649721-4649743 TAATATTCACAGTAGGAAGTAGG + Intergenic
926233269 2:11020809-11020831 GAATATTCACAAGAGGGAGATGG - Intergenic
926354527 2:12028999-12029021 CAATATGTAAAACATGAAGTTGG - Intergenic
928767637 2:34666600-34666622 CCATTTGCAAAAGAGGAAGCTGG + Intergenic
930782339 2:55234911-55234933 GAATAAGCACAAGAGAAAGAAGG + Exonic
931156490 2:59637807-59637829 AAAGATGCTCAAAAGGAAGTTGG - Intergenic
932049465 2:68384204-68384226 GAATAAGAACAAGAGGAAGAAGG - Intronic
932069031 2:68597987-68598009 AAATGTCCACAAGAGGAAGCAGG + Intronic
932124462 2:69131293-69131315 GAATATGGAAAAGAGGAATTTGG - Intronic
932724642 2:74168849-74168871 AAATATGCCCAGGTGGAAGTTGG + Intronic
933137620 2:78757934-78757956 CAATATTCACAAGAGGAAATTGG - Intergenic
933983362 2:87571543-87571565 CAGTTTCCAAAAGAGGAAGTGGG + Intergenic
934561702 2:95317028-95317050 TAAAATGCAGAAGGGGAAGTGGG - Intronic
934664568 2:96160929-96160951 CACTATGCACAACAGCAAGGAGG + Intergenic
935928602 2:108098345-108098367 CAATATTCATAAGAGCCAGTGGG + Intergenic
936310486 2:111379251-111379273 CAGTTTCCAAAAGAGGAAGTGGG - Intergenic
936806163 2:116334885-116334907 AAATATCCACAAGAGAAAGCAGG - Intergenic
936844181 2:116810523-116810545 CAATGTGTACAAAAGGAAATTGG - Intergenic
938053659 2:128197249-128197271 CAGTAGGCACGACAGGAAGTGGG + Intergenic
938343755 2:130551982-130552004 CATAATGCTCAAAAGGAAGTTGG + Intergenic
938346078 2:130568740-130568762 CATAATGCTCAAAAGGAAGTTGG - Intergenic
939396033 2:141630806-141630828 CAATATGCACAATTGATAGTTGG - Intronic
940055529 2:149509046-149509068 GAATATTCACATGAGGAATTGGG + Intergenic
940295017 2:152113577-152113599 CAATATGCAAAAAATGAAGTTGG + Intergenic
941464980 2:165814792-165814814 AAATATGCACAAGACCAAGTAGG + Intergenic
942191486 2:173474900-173474922 AAATCTCCACAAGAGGAAGCTGG + Intergenic
943679470 2:190752752-190752774 CTACTTGCAGAAGAGGAAGTCGG + Intergenic
944169148 2:196755741-196755763 AAATGTCCACAAGAGAAAGTAGG - Intronic
944862076 2:203824674-203824696 CAAGATGGCCAAGAGGTAGTGGG + Intergenic
945403040 2:209411022-209411044 CCACATGCAAAAGATGAAGTTGG + Intergenic
946220906 2:218225992-218226014 CAATATGAAAAATAGGAAATAGG + Intronic
947317914 2:228882055-228882077 CAATCTGCCAATGAGGAAGTGGG + Intronic
1169001009 20:2168014-2168036 CAAGATGCACAATAAGAACTGGG - Intronic
1169036362 20:2455728-2455750 CAATATACAAAAGAGGACATAGG + Intergenic
1169134600 20:3189719-3189741 CATCAGGCACCAGAGGAAGTAGG + Intergenic
1169934193 20:10865336-10865358 CAATTTGCATAAGAGGAAAGAGG + Intergenic
1170066795 20:12319505-12319527 CAGTATACACAAGAGAAATTGGG - Intergenic
1172128268 20:32638431-32638453 CCATTTGCAGAAGAGGAAGGAGG + Intergenic
1172383756 20:34518007-34518029 CAATATGAACATGAGGATGTAGG + Intronic
1172595657 20:36149487-36149509 GAAGATGGAGAAGAGGAAGTAGG + Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1173314299 20:41929830-41929852 CAATAGCCCCAAGAGGGAGTGGG - Intergenic
1175294624 20:57899928-57899950 CAATATGCAAACCAGGAAGAGGG - Intergenic
1177658312 21:24048698-24048720 TTATATGCCCAAGAGCAAGTTGG + Intergenic
1177779842 21:25610525-25610547 CAAGAAGCACAAGACCAAGTAGG - Intergenic
1178019648 21:28394383-28394405 GAAAATGCCCAAGAGGAAGAAGG + Intergenic
1179037206 21:37768693-37768715 CAATAAGCACAAGAGGCAACAGG + Intronic
1180598941 22:17001408-17001430 CAATTTGATCAAGAGGAAGAAGG - Intronic
1182045415 22:27270446-27270468 CAATATGCCTCAGAGGAAGGAGG + Intergenic
1183196989 22:36360376-36360398 CAATATGCACAAAATGTTGTAGG + Intronic
951592956 3:24286091-24286113 CCATATGCAAACCAGGAAGTGGG + Intronic
953535690 3:43775107-43775129 GAATATGCTGAAGAGGAAGCTGG - Intergenic
953861745 3:46550209-46550231 TAATTTGCAGATGAGGAAGTTGG - Intronic
955567023 3:60258381-60258403 CATTTTGAAGAAGAGGAAGTGGG - Intronic
956592995 3:70935306-70935328 CAATATAAACAACATGAAGTTGG - Intergenic
958691055 3:97466782-97466804 CAATATGCACAAGAGGAAGTTGG - Intronic
959092784 3:101922160-101922182 AAATACCCACAAGAGAAAGTAGG - Intergenic
959345524 3:105190019-105190041 CAATATGCCCAAAAGGAAGATGG - Intergenic
959421989 3:106140063-106140085 GAGTATGCACAACAGGGAGTAGG - Intergenic
959600245 3:108174339-108174361 CAAAATGAAGAAGAAGAAGTGGG + Intronic
962179686 3:133192754-133192776 GAGTATGCACAGGAGGAAGCGGG + Intronic
963144216 3:141975782-141975804 CAATATCAAAAAGAGGAAATTGG - Intronic
963292557 3:143507055-143507077 TAATATGCACAAGATGAATAAGG - Intronic
964965457 3:162486859-162486881 CAATGTGCAGAAGACTAAGTAGG - Intergenic
967119076 3:186366558-186366580 CACTTTGCAGAAGAGGAAATTGG - Intergenic
967389456 3:188941246-188941268 CATTTTGCACAAGGGGAAGCGGG + Intergenic
967454005 3:189660244-189660266 CAATATGCAGAAGATGAAACTGG - Intronic
968725180 4:2243788-2243810 CAGTTTGGACAGGAGGAAGTGGG + Intergenic
969175437 4:5395357-5395379 CATTTTGCAGATGAGGAAGTAGG - Intronic
970881202 4:20934190-20934212 AAACATGGACAGGAGGAAGTTGG - Intronic
971101917 4:23476272-23476294 CAATTTGTACAAAAGCAAGTTGG - Intergenic
972249607 4:37286313-37286335 CAATAAGCACAAGTGTAATTTGG - Intronic
974046621 4:56904088-56904110 CAATATGCAGAAGAGCAGGCAGG + Intergenic
975306364 4:72853798-72853820 AAATATCCACAAGAGAAAGCAGG + Intergenic
975483889 4:74913313-74913335 AAATATCCACAGGAGAAAGTGGG - Intergenic
975748021 4:77493618-77493640 AAATATGTAAAAGAGGAACTAGG + Intergenic
977844190 4:101747015-101747037 CAACATGCTCAAGAGGCAGGAGG + Intronic
980604941 4:135077761-135077783 AAATATCCACAAGAGAAAGCAGG - Intergenic
980653074 4:135746411-135746433 GAATATACACAAAAGAAAGTGGG + Intergenic
981068616 4:140511216-140511238 AAATGTGCACAAGAGAAAGCAGG + Intergenic
981635014 4:146867194-146867216 CAACAAGGACAAGAGGAAATAGG - Intronic
983181294 4:164652078-164652100 CAATGCCCACAAGAGGAAGCAGG + Intergenic
984493953 4:180471417-180471439 AAATATCCACAGGAGAAAGTGGG + Intergenic
984979349 4:185263243-185263265 TAATAAGCACTGGAGGAAGTTGG - Intronic
985299685 4:188474992-188475014 CACTAAGCACAAGAGGAGGAAGG - Intergenic
986523043 5:8642402-8642424 CAAAAAGTAGAAGAGGAAGTTGG + Intergenic
987190091 5:15468654-15468676 CCAGATGCACAAAAGGAAGAGGG + Intergenic
988151291 5:27385111-27385133 CTATAATCATAAGAGGAAGTTGG - Intergenic
991071077 5:62481216-62481238 CAATTAGGAAAAGAGGAAGTCGG - Intronic
991262906 5:64686025-64686047 TAATATGCACAGGTGGCAGTGGG - Intergenic
992809999 5:80377164-80377186 CAAAAGGCAGAAGAGGAAGAGGG - Intergenic
993856560 5:93083558-93083580 TAATATGCACCCTAGGAAGTAGG + Intergenic
996427620 5:123332466-123332488 AAATATCCACAAGAGAAAGCAGG - Intergenic
996837406 5:127808723-127808745 GAATATGCACAAGGAGAGGTTGG - Intergenic
997888111 5:137649691-137649713 CATTTTGCAGATGAGGAAGTTGG - Intronic
1000025572 5:157356201-157356223 CCATCTGCACACCAGGAAGTGGG - Intronic
1000971591 5:167720907-167720929 CTCTATGCAGAAGACGAAGTTGG + Intronic
1003243434 6:4364393-4364415 CCATTTGCAAAACAGGAAGTGGG - Intergenic
1005109456 6:22264078-22264100 GAATATGAACAAGATGAAATTGG - Intergenic
1008780007 6:55092057-55092079 AAATATCCACAAGAGAAAGCAGG + Intergenic
1012375183 6:98553678-98553700 CAAAAAGCAAAAGAAGAAGTAGG + Intergenic
1012520150 6:100111542-100111564 CAACATCCACAAGAGGTGGTGGG - Intergenic
1013027630 6:106293325-106293347 CAATATGCACAATAGGATTGTGG + Intronic
1013766648 6:113581767-113581789 GAATAAGCACAAGAGAAAGAAGG + Intergenic
1013831813 6:114281631-114281653 CAAGAAGAAAAAGAGGAAGTAGG + Intronic
1015326979 6:131934172-131934194 CTAGATGTACAAGAGGAAGGAGG + Intergenic
1016125189 6:140392929-140392951 CAATATGCAAAAAATGAAGTTGG + Intergenic
1016756885 6:147697025-147697047 ACATCTGCACACGAGGAAGTGGG - Intronic
1017503835 6:155049180-155049202 CCAAATGCACATGCGGAAGTGGG + Intronic
1021039561 7:15845192-15845214 CAATATGACCAAGTAGAAGTGGG + Intergenic
1028307177 7:89280285-89280307 AAATGTCCACAAGAGGAAGCAGG + Intronic
1028634685 7:92974417-92974439 TAATATGCATAAAAAGAAGTAGG - Intergenic
1030668151 7:112304970-112304992 CAGTAAGCACAGGAGAAAGTGGG - Intronic
1030755324 7:113280922-113280944 CAATAGGCATAAAAGGAAATAGG - Intergenic
1030770834 7:113473067-113473089 AAATGCCCACAAGAGGAAGTGGG - Intergenic
1030775844 7:113533496-113533518 CACCGTGCACAAGCGGAAGTAGG + Intergenic
1030994354 7:116340275-116340297 CTATGTGCAGAAGTGGAAGTGGG - Intronic
1031807278 7:126323532-126323554 CAATATACACAAGAAAAAATAGG - Intergenic
1032509541 7:132461211-132461233 CAATATGTAAATGAGGGAGTGGG + Intronic
1034840141 7:154387845-154387867 AAATAAGCAGAAGAGAAAGTCGG - Intronic
1035149109 7:156852180-156852202 CAATAAACACCAGAGGAAATGGG + Intronic
1035954311 8:4059319-4059341 AAATGTCCACAAGAGAAAGTAGG + Intronic
1035964667 8:4177457-4177479 AAATGTCCACAAGAGAAAGTAGG + Intronic
1036389936 8:8316679-8316701 TAATATGCAGAAGAGGACCTGGG + Intergenic
1036776334 8:11615397-11615419 CACAAGGCCCAAGAGGAAGTGGG - Intergenic
1038414721 8:27386198-27386220 CAAAATGCTCAGGGGGAAGTCGG - Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1039432529 8:37536110-37536132 CAAGATTCAGAAGAGGAATTTGG - Intergenic
1039768479 8:40658283-40658305 TAATATGCATAGGAGGAACTAGG - Intronic
1041742943 8:61176436-61176458 CAAAATTCACAAGAGTAACTTGG - Intronic
1043652717 8:82618064-82618086 CAATCTGCACAAGAGCTAATTGG - Intergenic
1044551495 8:93517636-93517658 CAATAAGGACAAGAGTAATTGGG + Intergenic
1046285207 8:112084843-112084865 AAATGTCCACAAGAGGAAGCAGG + Intergenic
1046793979 8:118350506-118350528 CAAAATACACACCAGGAAGTAGG - Intronic
1047755702 8:127916799-127916821 CAATAAAATCAAGAGGAAGTGGG - Intergenic
1047982780 8:130200246-130200268 AAATATTCAAAACAGGAAGTTGG + Intronic
1048395200 8:134007690-134007712 CATTGTGCACATGAGGAAGCAGG - Intergenic
1048756374 8:137742710-137742732 AAATACCCACAAGAGAAAGTGGG - Intergenic
1049057330 8:140248461-140248483 CCGTCTGCACAAGAGGAAGCCGG - Intronic
1050555966 9:6789941-6789963 CAATGCACACATGAGGAAGTAGG - Intronic
1050893435 9:10854249-10854271 CAAGATAAACAAGTGGAAGTGGG - Intergenic
1055141840 9:72885181-72885203 AAATATTCACAAGAAGAAGAAGG + Intergenic
1055967215 9:81877147-81877169 CAATTTACACAGAAGGAAGTAGG - Intergenic
1056324937 9:85469285-85469307 CAAGATCCACAAGAGCAAGGCGG + Intergenic
1057745721 9:97749350-97749372 CAAAATGCACAAGATGAGTTTGG - Intergenic
1060124836 9:121033573-121033595 CAAGTGGCACAAGATGAAGTTGG + Intronic
1185878286 X:3717415-3717437 GAATAAGCACAAGAGAAAGAAGG + Intergenic
1188670189 X:32872695-32872717 CAAGATGCACAAAGGGAAGTAGG + Intronic
1192686281 X:73308796-73308818 AAATGTCCACAAGAGAAAGTGGG + Intergenic
1192702907 X:73495159-73495181 AAATGTGCACAAGAGAAAGCAGG - Intergenic
1193490931 X:82146404-82146426 CAATATCCACAAGGAGAAGAGGG + Intergenic
1193661577 X:84264940-84264962 AAATATCCACAAGAGAAAGCAGG - Intergenic
1193701158 X:84762628-84762650 ATGTATGGACAAGAGGAAGTAGG - Intergenic
1194054346 X:89112748-89112770 CAATATGAAGAATAGCAAGTAGG - Intergenic
1196328292 X:114435283-114435305 CAAAATGCACAAGACATAGTTGG + Intergenic
1199301790 X:146221573-146221595 CAAAATGTTCAAGAGGAAGCAGG - Intergenic
1200524902 Y:4261783-4261805 AAATATGCACAAGAGCAATTAGG - Intergenic
1201050491 Y:9928376-9928398 TAATATCCACAAGAGAAAGTAGG + Intergenic
1201262337 Y:12171997-12172019 AAATGCCCACAAGAGGAAGTAGG + Intergenic
1201912830 Y:19150871-19150893 CAACATGCAAAAGTGGAAGAAGG - Intergenic