ID: 958693407

View in Genome Browser
Species Human (GRCh38)
Location 3:97497435-97497457
Sequence TAGTTTATGAAGGACCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958693407 Original CRISPR TAGTTTATGAAGGACCTGAA AGG (reversed) Intronic
903548813 1:24143371-24143393 TGGTTTATCAAGGAGCTGAGGGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905817382 1:40962335-40962357 TATTTTATTAAGGACAAGAAAGG + Intergenic
907551143 1:55305686-55305708 TAGACTAAGAAGGACCTAAAAGG + Intergenic
908220233 1:61998688-61998710 AACTCTATGAAGGAACTGAAGGG - Intronic
909040556 1:70644647-70644669 CAGATTATGAAGTCCCTGAATGG + Intergenic
909148924 1:71975413-71975435 TAGATTAGGAAGGACATGATAGG + Intronic
910023415 1:82621209-82621231 CAGCTTATGAACAACCTGAATGG - Intergenic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
916491302 1:165304736-165304758 TAGATTATGAAGGTCCAGACAGG - Intronic
916511078 1:165472988-165473010 TAGTTTGTTCAGGACCTGAATGG - Intergenic
917950919 1:180035010-180035032 AAGTTTTTGAAGGAAATGAAAGG + Intronic
919335596 1:196228017-196228039 TAATATTTGAAGGACCTCAATGG - Intronic
919645055 1:200087082-200087104 TAGTTTCTAAAGTAGCTGAAGGG + Intronic
921687627 1:218108281-218108303 CATTTTGTGAAGGAGCTGAAGGG + Intergenic
921919072 1:220645855-220645877 TAGTTTATTGAGAACATGAAGGG - Intronic
922421970 1:225466254-225466276 AAGTTTATTAAGGAAGTGAAGGG + Intergenic
923291948 1:232554016-232554038 TAGTTTATAAATGTCCTGGATGG - Intronic
1062890066 10:1052207-1052229 TAGTTTATGAAGTAGCAGCAGGG - Intronic
1064729970 10:18320115-18320137 CAGTTTATGGAGGAGCTGACAGG - Intronic
1064731727 10:18338238-18338260 AAATGTATGAAGGACCTGAATGG + Intronic
1065690115 10:28324154-28324176 TAGGTCATGAAGGTTCTGAATGG + Intronic
1066766078 10:38804100-38804122 TAGTTTCTAAAGGAATTGAATGG - Intergenic
1066769408 10:38831976-38831998 TAGTTTCTAAAGGAATTGAATGG + Intergenic
1068089490 10:52415322-52415344 TAAATTATGAAGGAATTGAATGG - Intergenic
1068408750 10:56627056-56627078 TGGTTTGTGAAGAAGCTGAATGG - Intergenic
1070346509 10:75547901-75547923 TGGTTTATGTAGGACCTGCTGGG + Intronic
1071796419 10:89011354-89011376 TAGTTGATGAATGACTTAAAGGG - Intronic
1073401548 10:103261547-103261569 CAGATTATCAAGGACCTCAAAGG + Intergenic
1077750992 11:4969975-4969997 TAGTTTATAAAATACCTTAAAGG - Intronic
1078160775 11:8837905-8837927 GAGTTTATGAAGGAGGTGGAAGG + Intronic
1085903624 11:80732961-80732983 TAGTTTCTGGAGGACTCGAATGG - Intergenic
1089288505 11:117422890-117422912 TAATTTATGCAGGAGATGAAGGG - Intergenic
1098296410 12:69008628-69008650 TAGTTTGTGTGGTACCTGAATGG - Intergenic
1103997926 12:124842069-124842091 CTGTTTATGAACCACCTGAATGG - Intronic
1106139536 13:27000692-27000714 TAGCTGATGAAAGACCTAAAAGG - Intergenic
1107732622 13:43364002-43364024 TAAATTATGTTGGACCTGAAAGG + Intronic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1108305228 13:49124920-49124942 AAGTTTATGAACTACCTGAATGG + Intronic
1109243828 13:59928362-59928384 AAATTTATAAAAGACCTGAAAGG - Intronic
1110115139 13:71804737-71804759 TAGTTTATGATGGAAGAGAAAGG - Intronic
1111135050 13:84030384-84030406 TAGTTTATAAAGCACCAGCAGGG - Intergenic
1111480712 13:88822212-88822234 TTCTTTATGAATGAACTGAATGG - Intergenic
1111825778 13:93265130-93265152 TACTCTGTGAAGGACCTGAGAGG + Intronic
1118664585 14:68053693-68053715 TATTTTATCAAGAACCTAAAAGG - Intronic
1119048716 14:71344899-71344921 TGGATTTTGAAGGACCTTAATGG + Intronic
1119982034 14:79092785-79092807 TTGTTCATGAAGGACTTGCATGG + Intronic
1121882721 14:97515040-97515062 TAGTGCATGAAAGGCCTGAAGGG - Intergenic
1125728421 15:41879924-41879946 TAGCCTATGACGGACCTGAGTGG + Intronic
1126499760 15:49332472-49332494 ATATTTATGAAGGACTTGAATGG + Intronic
1128626554 15:69212586-69212608 TAGATAAGAAAGGACCTGAATGG + Intronic
1131084756 15:89566856-89566878 GGGTTTATGGAGGACCGGAAGGG - Intergenic
1133506745 16:6419687-6419709 TAGTCTATGAAGAACGGGAATGG - Intronic
1134512514 16:14859944-14859966 TAGGATAGGAAGGACCTGAAAGG + Intronic
1134700156 16:16258440-16258462 TAGGATAGGAAGGACCTGAAAGG + Intronic
1134827458 16:17296103-17296125 TATTTTATGTGGGACCTAAAAGG + Intronic
1134971670 16:18536217-18536239 TAGGATAGGAAGGACCTGAAAGG - Intronic
1135762051 16:25145622-25145644 CAGTTTGTGTAGGACTTGAAGGG - Intronic
1138723812 16:59113701-59113723 TAGTTTATCAATGTCCTGAAAGG + Intergenic
1139228329 16:65255065-65255087 GAGTCCATGAAGGACTTGAAAGG + Intergenic
1139790700 16:69432090-69432112 TAGTGAATGAAGGACAAGAATGG + Intronic
1140766840 16:78167855-78167877 GAGGTGAGGAAGGACCTGAAGGG - Intronic
1140800984 16:78488125-78488147 TAGATTTTGGAGGACTTGAAAGG + Intronic
1141804817 16:86335663-86335685 TTGTTTAGGTAGGGCCTGAAGGG - Intergenic
1142397803 16:89842639-89842661 TAGTCTGTGAAGGCACTGAAGGG + Intronic
1145330658 17:21869261-21869283 TAGTTTCTAAAGGAATTGAATGG + Intergenic
1149248571 17:54741034-54741056 GAGGTTATGAAGGAGCTGATAGG - Intergenic
1156381889 18:36569546-36569568 AAGGCTATGAAGGAACTGAATGG + Intronic
1156824950 18:41419584-41419606 TATTTTTTGAATGACCTGATAGG + Intergenic
1166536861 19:43580173-43580195 GGGTTAAGGAAGGACCTGAAAGG + Intronic
926662908 2:15488078-15488100 TATTTCCTGAATGACCTGAATGG - Intronic
928232879 2:29515102-29515124 CAGCATATGAAGGACCTGAAGGG - Intronic
929481894 2:42316455-42316477 TAGATTCTAAAGGACTTGAAGGG - Intronic
930228301 2:48817149-48817171 TATTTTAGGATGGATCTGAATGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932109347 2:68981119-68981141 TGGTGTCTGAAGCACCTGAAGGG - Intergenic
934854313 2:97719398-97719420 GAGTTTGTGAAGGACCAGAGAGG + Intronic
937690051 2:124745249-124745271 TTGTTTATGAACTACCCGAAAGG - Intronic
937950658 2:127385078-127385100 TAGTTGATGAAGGGTTTGAAAGG + Intronic
938481028 2:131661749-131661771 TAGTTTATGAAAGACTTGCCTGG + Intergenic
939357961 2:141128419-141128441 CAGATTATGTAGGACCTGACTGG - Intronic
939529150 2:143335821-143335843 TGGTTCATGAAGGACTTGAAGGG + Intronic
940407248 2:153319217-153319239 TAGTTTATAAAGTACTTGCATGG - Intergenic
941985860 2:171511059-171511081 TATATTATGAAGGACATAAAAGG + Intergenic
946615424 2:221504192-221504214 TAGTTAATGAACCATCTGAATGG + Intronic
947619422 2:231579959-231579981 TAGTTATTGAAGGAATTGAATGG - Intergenic
948774579 2:240277258-240277280 GAGTTTATTGAGGACTTGAAAGG - Intergenic
1171367125 20:24632903-24632925 TATTTTATGAAGGCTCTGGAGGG + Intronic
1174679862 20:52395872-52395894 AAGTTTATGAAGGAGCTCGAAGG + Intergenic
1178013269 21:28312069-28312091 TATTTCATGAAAAACCTGAAAGG + Intergenic
1178152032 21:29806284-29806306 TGGTTTTTGAATGACCTGGATGG - Intronic
1178617449 21:34146233-34146255 TTGTTCATGAAGCATCTGAAGGG + Intergenic
1178848950 21:36197328-36197350 CAGGTTATGCAGGACATGAAAGG - Intronic
1183497786 22:38159202-38159224 TAATGTATGGAGGATCTGAAGGG - Intronic
1185163075 22:49241202-49241224 TAGGTGATGGAGGCCCTGAAAGG + Intergenic
955067583 3:55546231-55546253 TAGTCTGTGAAGGACCAGCAGGG - Intronic
955787742 3:62557672-62557694 GAGGTTATGAAGGACCAGAGAGG - Intronic
956196915 3:66662114-66662136 TAGTTACAGAGGGACCTGAAGGG + Intergenic
957329199 3:78738182-78738204 AAATTTGTGAAGGATCTGAAGGG + Intronic
958693407 3:97497435-97497457 TAGTTTATGAAGGACCTGAAAGG - Intronic
959158809 3:102698520-102698542 TAGGATATGAAGCACCTGCATGG + Intergenic
959496592 3:107059150-107059172 TAGTTGTTGAATGAGCTGAATGG - Intergenic
969921014 4:10539847-10539869 TATTTTATGTAAGAACTGAAAGG - Intronic
970100592 4:12516804-12516826 TAGTCTGTGAGTGACCTGAATGG - Intergenic
971739355 4:30500876-30500898 TACTCTATTCAGGACCTGAAAGG - Intergenic
972664551 4:41151885-41151907 GAGTTTATGAATGACATAAATGG - Intronic
977539174 4:98294994-98295016 TAGATACTGAAGGACATGAAGGG + Intronic
977567982 4:98600775-98600797 TGGATCATGAAGGACCTTAATGG + Intronic
978060766 4:104335005-104335027 TAGTTTATGAAGAATGTCAATGG - Intergenic
980159499 4:129142695-129142717 TATTTTATAAAGGATATGAAGGG - Intergenic
982374230 4:154671986-154672008 TAATTTATGAGGGACCAAAAGGG + Intronic
984470163 4:180159447-180159469 TAATTTATGATGAGCCTGAAAGG + Intergenic
987283467 5:16434802-16434824 TAGATTATGAAAGCTCTGAAGGG - Intergenic
987739491 5:21887688-21887710 TCATATATGAAGGACCTGGAGGG - Intronic
994520238 5:100824689-100824711 TATTTGATTAAGGAACTGAATGG - Intronic
995893884 5:116988350-116988372 AAGTCTATGCAGGACCTAAAGGG + Intergenic
998515520 5:142750242-142750264 TATTTAAACAAGGACCTGAAGGG - Intergenic
999706610 5:154278454-154278476 TACTTTATGAATCACCAGAAGGG + Intronic
1007316134 6:40990634-40990656 GAGTTGATGATGGACCTGGAGGG - Intergenic
1008328136 6:50210603-50210625 TAGGTGAGGAAGGACCTAAATGG + Intergenic
1011479614 6:87781000-87781022 TATTATATGAAGGACATGTAAGG + Intergenic
1013353389 6:109326229-109326251 TAGTTTAAGTACGCCCTGAAGGG + Intergenic
1014745381 6:125194340-125194362 TATTTCATGAATGACCTGAGGGG - Intronic
1014774822 6:125496497-125496519 TAGTTTATAAAGGACATCACTGG - Intergenic
1014973006 6:127842156-127842178 AAGTTTCTAAAGGACCTGATAGG - Intronic
1015416476 6:132954575-132954597 TATTTGATGAAGGTCATGAATGG - Intergenic
1018037705 6:159895436-159895458 TATTTTATAAAAGACATGAAAGG - Intergenic
1018535064 6:164810747-164810769 TATTTGTTGAATGACCTGAAAGG - Intergenic
1020714838 7:11659186-11659208 TAGTTTATGAATGTGCTAAAAGG + Intronic
1021960559 7:25868741-25868763 TAATTTTTGAAGGTGCTGAATGG - Intergenic
1022872390 7:34492981-34493003 TAGTTTTGGCAAGACCTGAAGGG - Intergenic
1023183730 7:37512205-37512227 TGGTCTCTGAAGGACCTGACTGG + Intergenic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1025523201 7:61768021-61768043 CGGTTTTTGAAGGACCTGCAAGG - Intergenic
1025546955 7:62187049-62187071 CGGTTTTTGAAGGACCTGCAAGG - Intergenic
1028863032 7:95676319-95676341 GAGTTTATGAAGGACCACACTGG - Intergenic
1029378585 7:100197796-100197818 AAGTGTGTGAAGGCCCTGAAAGG + Exonic
1031407689 7:121405994-121406016 TAGCTTGAGATGGACCTGAAAGG + Intergenic
1033769971 7:144539113-144539135 TATTTTAGGAAGGACCAGAGGGG + Intronic
1038129471 8:24713742-24713764 TATTTTATAATGGACCTAAAGGG - Intergenic
1038164308 8:25070111-25070133 AAGTGTATGAAGGTTCTGAAAGG - Intergenic
1038907522 8:31922662-31922684 TAGTTAATGAAGGACCAGGTAGG + Intronic
1040113165 8:43582972-43582994 TATTTTATTATGGACCTAAAGGG - Intergenic
1041857377 8:62473202-62473224 TAGCTTCTGAAGAACTTGAAAGG + Intronic
1042729416 8:71915215-71915237 TAGTTAATGCAGGGCCTGATAGG + Intronic
1044204378 8:89475061-89475083 TAATATATGAAGGCCCTGAGCGG - Intergenic
1046913407 8:119653642-119653664 TAGTTTATGCAGGACCCTACAGG + Intronic
1052373242 9:27689635-27689657 TAGTTTATGGAAGAACTAAAAGG - Intergenic
1056735783 9:89208525-89208547 TAGTGTGTGAAGGAAGTGAAGGG - Intergenic
1058091711 9:100813439-100813461 TAGGTTATGAAGAACTTCAAAGG - Intergenic
1058672595 9:107372822-107372844 CAGGCCATGAAGGACCTGAAAGG + Intergenic
1060614268 9:124997261-124997283 TAGTTTATCCAGGATCTCAAAGG + Intronic
1187251375 X:17601159-17601181 TAGGTTATGAAGGAGAGGAAGGG + Intronic
1193263649 X:79441324-79441346 TTGTACATGAAGGACCTGTATGG + Intergenic
1194545722 X:95231204-95231226 CAGTTTGTGGAGGGCCTGAATGG - Intergenic
1195215411 X:102695584-102695606 TATTTTTTGTATGACCTGAAAGG + Intergenic
1195770013 X:108340896-108340918 TACTTTATAAAGGCCATGAAAGG + Intronic
1195938112 X:110144465-110144487 TGGAATATGAAGGACCTGAGTGG - Intronic
1199575884 X:149313135-149313157 TAAATTGTCAAGGACCTGAAAGG - Intergenic