ID: 958696852

View in Genome Browser
Species Human (GRCh38)
Location 3:97538783-97538805
Sequence TCATGGGAATGGAGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 680}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958696847_958696852 15 Left 958696847 3:97538745-97538767 CCATTGGATAGGGCAGAGGGCAC 0: 1
1: 0
2: 0
3: 15
4: 115
Right 958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG 0: 1
1: 0
2: 3
3: 56
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958696852 Original CRISPR TCATGGGAATGGAGGCCAGA TGG Intronic
901314487 1:8296829-8296851 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
901410307 1:9078366-9078388 TCCTGGGAATGCAGCCCAGTAGG + Intronic
901840832 1:11952906-11952928 TCATGGTTCTGGAGGCCGGAAGG + Intronic
902193177 1:14778103-14778125 TCCTGGGAATGCAGCCCAGTAGG + Intronic
902555481 1:17244314-17244336 CCAAGAGAATGGAGGCCAGGTGG - Exonic
903206475 1:21786045-21786067 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
903618284 1:24678641-24678663 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
903762478 1:25708537-25708559 TCCTGGGAATGCAGCCCAGTAGG + Intronic
904089104 1:27931999-27932021 TCATGAGAGTGGAGCCCTGATGG - Intergenic
904750832 1:32740885-32740907 CAACGGAAATGGAGGCCAGAAGG - Intergenic
904773986 1:32895659-32895681 TCATGGCGATGGAGGCCAAGAGG + Exonic
904909493 1:33923245-33923267 TCATGGGGATGGATGCCTCATGG + Intronic
904989383 1:34579371-34579393 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
905999263 1:42409903-42409925 TTATGGACAAGGAGGCCAGATGG + Intronic
906086143 1:43136271-43136293 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
907341964 1:53741402-53741424 TTAAGGGAATGGAGGACTGAGGG + Intergenic
907510164 1:54952080-54952102 TTCTGGGAATGCAGGCCAGTAGG - Intergenic
908329727 1:63059273-63059295 GCATGAGTTTGGAGGCCAGATGG - Intergenic
908851863 1:68385053-68385075 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
909521780 1:76576816-76576838 TCATGGGAATGGAGAAGAAATGG - Intronic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
910805105 1:91181933-91181955 TCATGGCTCTGGAGGCCAGGAGG + Intergenic
911062717 1:93761807-93761829 TCATGGGCATGTAGGCAAGTGGG - Intronic
911909530 1:103615483-103615505 GCAGGGGAATGGCGGCCTGAAGG - Intergenic
912486290 1:110031544-110031566 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
912939719 1:114034085-114034107 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
913097345 1:115531523-115531545 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
913608497 1:120488586-120488608 TCCTGGGATTGGAGACCAGGAGG + Intergenic
913669291 1:121080654-121080676 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
913986929 1:143574084-143574106 TCCTGGGATTGGAGACCAGGAGG - Intergenic
914021044 1:143868051-143868073 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
914370239 1:147018366-147018388 TCCTGGGATTGGAGACCAGGAGG + Intergenic
914437406 1:147671951-147671973 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
914484454 1:148095047-148095069 TCCTGGGATTGGAGACCAGGAGG - Intergenic
914582705 1:149033252-149033274 TCCTGGGATTGGAGACCAGGAGG - Intronic
914659535 1:149775978-149776000 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
914817788 1:151075769-151075791 TAATGGGAATGCAGCCCAGTAGG + Intronic
915468416 1:156111838-156111860 TGATGGGAGTGGTGGCTAGAGGG - Intronic
915491218 1:156250995-156251017 TCCTGGGGATGGGGGGCAGAGGG + Exonic
915634745 1:157178257-157178279 TCCTGGGAAGGGAGGGCAGTTGG + Intergenic
917950897 1:180034787-180034809 TCAGGGATAAGGAGGCCAGAGGG - Intronic
918248200 1:182679264-182679286 TGGTGGGAATGGAAGCCAAATGG - Intronic
918966732 1:191360317-191360339 TCATGGTTATAGAGGCCAGAAGG + Intergenic
919803796 1:201368929-201368951 ACCTGGGAAGGGAGGACAGAGGG - Intronic
919966532 1:202532389-202532411 TCTTGGGAATGCAGCCCAGTAGG + Intronic
920051633 1:203167964-203167986 TCTGGGGAAGGGAGGCCAGCAGG + Exonic
920249973 1:204617085-204617107 TGATGGGCATGGGGGCCAGCTGG - Intergenic
921053161 1:211525358-211525380 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
921474007 1:215583584-215583606 TCCTGGGAATGCAGCCCAGCAGG + Intronic
922090114 1:222387723-222387745 TGATAGGAATGGTGGACAGAAGG + Intergenic
922815038 1:228442765-228442787 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
922815847 1:228448637-228448659 TCCTGGGAATGCAGTCCAGCAGG - Intergenic
923347317 1:233066863-233066885 TCCTGGGTAAGGAGGCCACATGG + Intronic
924678484 1:246205366-246205388 TCATGGGAAAGGACTCCAGGAGG - Intronic
1062907289 10:1187430-1187452 TGATGGTCATGGAGACCAGAAGG - Intronic
1063472155 10:6296893-6296915 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1064012257 10:11743833-11743855 TTCTGGGCATGGCGGCCAGATGG + Intronic
1064745839 10:18477375-18477397 TCTTGGGAATGCAGCCCAGTAGG + Intronic
1065145454 10:22763641-22763663 TGATGAGGATGGAGCCCAGAGGG + Intergenic
1065173169 10:23051998-23052020 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1065383148 10:25110003-25110025 TCTTGGGAATGCAGCCCAGCAGG + Intergenic
1065696567 10:28386018-28386040 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1066268464 10:33798909-33798931 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1066302004 10:34105538-34105560 TCATGGGAGTAGAGGGCAGGAGG - Intergenic
1066386219 10:34943638-34943660 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1066386623 10:34946857-34946879 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1066640506 10:37550287-37550309 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1067924777 10:50497085-50497107 TCATTAGAATGAAGTCCAGAAGG + Intronic
1067932409 10:50576033-50576055 ACATGGGAAGTGATGCCAGAGGG - Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1069191369 10:65495141-65495163 TCCTGGGAATGCAGGCCAGGAGG - Intergenic
1069235134 10:66061703-66061725 TCATGAGAATGGAGGCCAGCAGG - Intronic
1069953615 10:72036192-72036214 CCTTGGAAATGGAGGCCCGAGGG - Intergenic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070558304 10:77546709-77546731 AGATGGGAAAGGAGGCCTGAAGG - Intronic
1071324075 10:84494480-84494502 TCCTGGGAATGTAGTCCAGCTGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072167675 10:92829685-92829707 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1072214266 10:93274618-93274640 TCCTGGGAATGGAGCCCAGCAGG - Intergenic
1072657619 10:97341308-97341330 TCATGCCACTGGACGCCAGATGG - Intergenic
1072934388 10:99698231-99698253 ACGTGGGAATGAAGACCAGATGG + Intronic
1074592832 10:114829663-114829685 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1074614235 10:115050608-115050630 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1075022563 10:118962425-118962447 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1075623125 10:123942301-123942323 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076421706 10:130336515-130336537 TCAGGGCCCTGGAGGCCAGAAGG - Intergenic
1076536444 10:131181002-131181024 TCATGAGAATGGAGGCAGCAGGG - Intronic
1076665394 10:132086686-132086708 TCATGGAAATGGACACCAAAAGG - Intergenic
1076991374 11:277904-277926 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1077463604 11:2723035-2723057 GCACGGGAATGGAGGCCAGGAGG - Intronic
1077521096 11:3035254-3035276 TCATGGGAAAGGGGGAGAGATGG + Intronic
1079083581 11:17430204-17430226 TCTTGGGAATGAAAGCCTGAAGG - Intronic
1079235030 11:18682091-18682113 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1079236101 11:18691671-18691693 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1080572459 11:33568597-33568619 TCAGAGGAATGGAGGTGAGAGGG - Intronic
1081530178 11:43953127-43953149 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1081561718 11:44223584-44223606 TTATAGAAATGGAGGACAGATGG + Intronic
1082223444 11:49671241-49671263 TCAGGAAAATGGAGGCCAAAAGG - Intergenic
1082273774 11:50199892-50199914 TTATGGGTATGGAGCCAAGATGG - Intergenic
1082906051 11:58309743-58309765 TGATGGGAGTGGAGCCAAGATGG - Intergenic
1083025612 11:59548215-59548237 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1083283161 11:61639977-61639999 TCCTGGGAATGAAGCCCAGTGGG - Intergenic
1083349060 11:62014126-62014148 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084686704 11:70700384-70700406 TCAATGGAGTGGAGGGCAGAGGG - Intronic
1084878962 11:72155935-72155957 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1085590160 11:77752763-77752785 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1085725662 11:78952481-78952503 ACAGGGGCAGGGAGGCCAGAAGG + Intronic
1086100132 11:83090850-83090872 TCATGTGAATGGATTACAGAGGG - Intergenic
1086312427 11:85549608-85549630 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1086487734 11:87326537-87326559 TTATGGGATTGGATGCCAAAAGG + Intergenic
1086843315 11:91716846-91716868 TGATGAGAATGGAGACCAGTGGG - Intergenic
1087066813 11:94035211-94035233 TTATGGGAATTTAGGACAGAGGG - Intronic
1087202841 11:95363522-95363544 TCATGGGAGATGAGGCCAGAGGG + Intergenic
1087251406 11:95904440-95904462 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1087466616 11:98515699-98515721 TCATGAGAAGGGAGACCAGCAGG + Intergenic
1087965274 11:104404992-104405014 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1088481420 11:110299260-110299282 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1089133750 11:116232990-116233012 GCAAAGGTATGGAGGCCAGAAGG - Intergenic
1089472768 11:118734168-118734190 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1089572058 11:119417570-119417592 TCCTGGGATTGGGGGCAAGAGGG - Exonic
1089749639 11:120641817-120641839 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1090279070 11:125440840-125440862 TCTTGGGATTTGAGGACAGAGGG - Intergenic
1090413492 11:126525084-126525106 TCATGGCACTGGATGCTAGAGGG + Intronic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1090814304 11:130277941-130277963 TTATAGCAGTGGAGGCCAGAAGG - Intronic
1091069395 11:132549034-132549056 TCCTGGGAATGCAGCCCAGGAGG - Intronic
1091328918 11:134715076-134715098 TCATGGGCAGGGAAGCCAGCTGG + Intergenic
1091362799 11:134991455-134991477 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1091654048 12:2331838-2331860 TCATGGTCATGGAAGACAGAGGG + Intronic
1091894045 12:4086156-4086178 GCAAGGGAATGGACGCCAAAGGG - Intergenic
1092121828 12:6049815-6049837 TCATGGAAATGAAGGGCAGAAGG - Intronic
1092653524 12:10660540-10660562 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1092981227 12:13796397-13796419 TCAGGGGGAAGAAGGCCAGAGGG + Intronic
1093170475 12:15854061-15854083 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1093464459 12:19435991-19436013 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1094432849 12:30388912-30388934 TCATGGGAATGGATCCCTCATGG - Intergenic
1094484978 12:30917925-30917947 CCATGTAAATGGAGGCCTGAAGG - Intergenic
1094588147 12:31796703-31796725 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1095158978 12:38893231-38893253 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1095178843 12:39123761-39123783 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1095278986 12:40327245-40327267 TCAAGGGTATGGAGGCCTGAAGG + Intronic
1095305775 12:40637513-40637535 TCTTGGGAATGCAGACCAGTAGG - Intergenic
1096262978 12:50104433-50104455 TCATGGGAGTGGAGGTGATAAGG + Intronic
1096518358 12:52170618-52170640 CCCTGGGAGTGGAAGCCAGATGG - Exonic
1097166589 12:57089403-57089425 ACTTGGGAATGGGGTCCAGAGGG + Intronic
1097964237 12:65562065-65562087 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1098228851 12:68352265-68352287 TCCTGGGAATGGAGCCAAGTCGG - Intergenic
1098371872 12:69768447-69768469 TCCTGGGAATGGAGCAGAGAAGG + Intronic
1098640722 12:72835620-72835642 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1098938584 12:76508517-76508539 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1099397566 12:82159624-82159646 TAATGCTAAAGGAGGCCAGAGGG + Intergenic
1100426649 12:94493571-94493593 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1100448682 12:94684663-94684685 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1100701337 12:97151748-97151770 TCCTGGGAATGTAGCCCAGTAGG + Intergenic
1101003822 12:100382277-100382299 AGATAGGAATGGAGGCCACAGGG + Intronic
1101133671 12:101716145-101716167 TCAGGGGAATGCAGACTAGAGGG + Intronic
1101418781 12:104531944-104531966 TGAAGGAAATGGAGGCTAGAGGG + Intronic
1101683870 12:106997336-106997358 TAATGGGAATGGAGGCTTCATGG - Exonic
1101694306 12:107109952-107109974 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1102410763 12:112716239-112716261 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1102526150 12:113513817-113513839 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1102775124 12:115512040-115512062 TAATGGGAATGAAGGCATGAGGG - Intergenic
1103236234 12:119375080-119375102 TCCTGGGAATGCAGCCCAGTTGG + Intronic
1103846734 12:123907210-123907232 TCATGGTCATGGAGGGCGGAGGG + Intronic
1104041442 12:125133865-125133887 GCATGGGGCTGGGGGCCAGAGGG - Intronic
1104118259 12:125771667-125771689 TCATGGGAATGGATCCCTCATGG - Intergenic
1104233236 12:126905577-126905599 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1104237527 12:126953525-126953547 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1104464434 12:128979062-128979084 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1104800676 12:131553591-131553613 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1104810503 12:131617531-131617553 TCCTGGGAATGGAGGCGACTGGG + Intergenic
1106041273 13:26096176-26096198 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1106106844 13:26740525-26740547 TCATGGGCATGGAAGTGAGAGGG + Intergenic
1107069945 13:36258364-36258386 TCCTGGGAATGCAGCCCAGTGGG - Intronic
1107127675 13:36862225-36862247 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1107708692 13:43131908-43131930 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1108459359 13:50649703-50649725 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1108509187 13:51139499-51139521 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1108900837 13:55406315-55406337 TCATGGGAAAGCAGCACAGAAGG - Intergenic
1108913981 13:55586236-55586258 TCCTGGGAATGCAGCCCAGGAGG - Intergenic
1109177402 13:59173406-59173428 TCCTGGGAATGCAGTCCAGAAGG - Intergenic
1109934132 13:69259112-69259134 TCTTGGGAATGTAGCCCAGTAGG - Intergenic
1110339681 13:74374787-74374809 TCATGGGAATTAAGGCCATCAGG - Intergenic
1112255474 13:97826635-97826657 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1113270004 13:108662844-108662866 TCATTGGGAGGGTGGCCAGAGGG - Intronic
1113844793 13:113380727-113380749 TCCTGGGAATGCAGTCCAGAAGG - Intergenic
1114393044 14:22330830-22330852 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1114982768 14:28186893-28186915 TCCTGGGAATGCAGTCCAGTAGG - Intergenic
1115138508 14:30140908-30140930 TCCTGGGAATGCAGTCCAGTAGG - Intronic
1115140691 14:30168087-30168109 TCATGGGAGTGGATGCCTCATGG - Intronic
1115811907 14:37118883-37118905 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1116093438 14:40337263-40337285 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1116897684 14:50333194-50333216 TCCTGGGAATGCAGCCCAGTAGG - Exonic
1117448854 14:55831378-55831400 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1117515860 14:56500505-56500527 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1118377345 14:65188629-65188651 TCAGGGGAATGGATAGCAGAAGG + Intergenic
1118427797 14:65685991-65686013 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1118461047 14:65987426-65987448 ACATGGGAATGGAAACCAGATGG + Intronic
1118578476 14:67268820-67268842 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118885222 14:69860339-69860361 TCTTGGGAATGGAGGGCCCAGGG - Intronic
1119022993 14:71130738-71130760 TCCTGGGAATGGAGCCCAGTAGG - Intergenic
1119101433 14:71883567-71883589 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1120061291 14:79985945-79985967 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1120121038 14:80680406-80680428 TCCTGGGCATGGAGCGCAGAGGG - Intronic
1120895269 14:89525150-89525172 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1120930646 14:89844824-89844846 TCATGGGGCCTGAGGCCAGAGGG - Intronic
1121260975 14:92565867-92565889 TCCTGGGAATGCAGCCCAGCCGG + Intronic
1121262366 14:92575854-92575876 TCCTGGGAATGCAGCCCAGCGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121666890 14:95679358-95679380 TCATGGGAATGCAGCCCAGTAGG - Intergenic
1121794049 14:96721114-96721136 TCCTGGGAATGCAGTCCAGTAGG + Intergenic
1121795160 14:96728458-96728480 ACAAGGGAATCAAGGCCAGAGGG - Intergenic
1122156511 14:99753392-99753414 TCCTGGGCAGGGAGGCCGGAGGG - Intronic
1122591653 14:102856630-102856652 TCCTGGGAATGTAGCCCAGTGGG + Intronic
1122638701 14:103143739-103143761 TCCTGGGAATGTAGCCCAGCAGG - Intergenic
1122677487 14:103427948-103427970 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1123581953 15:21723373-21723395 TGATGGGACTGGAGTACAGAAGG + Intergenic
1123618602 15:22165973-22165995 TGATGGGACTGGAGTACAGAAGG + Intergenic
1124032749 15:26026394-26026416 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1125629962 15:41139239-41139261 TCCTGGGAATGCAGTCCAGCAGG - Intergenic
1126157851 15:45582107-45582129 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1126172831 15:45708497-45708519 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1126521631 15:49601823-49601845 TCATGGAAATAGAGAGCAGAAGG - Intronic
1126941411 15:53769926-53769948 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1127018830 15:54722043-54722065 TCATGGCAATAGAGGGTAGAAGG - Intergenic
1127113463 15:55699304-55699326 TCATTGGAAGGGGTGCCAGAAGG - Intronic
1127842687 15:62844646-62844668 TCATGGGAATGGGAGGAAGATGG + Intergenic
1127860182 15:62987515-62987537 TCATTGAATAGGAGGCCAGAAGG - Intergenic
1128309957 15:66624086-66624108 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1128342010 15:66829043-66829065 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1128465666 15:67909011-67909033 TCCTGGGAATGCAGCCCAGTCGG - Intergenic
1129009360 15:72401205-72401227 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1129530413 15:76260446-76260468 TCATGACCATGCAGGCCAGAAGG - Intronic
1130694334 15:86115198-86115220 TCATGGGACTGGAAGCAAGATGG - Intergenic
1131113895 15:89782354-89782376 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1131455885 15:92582250-92582272 ACATGGGAATAGAGGACACATGG - Intergenic
1131564502 15:93473447-93473469 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1132176689 15:99721581-99721603 TCATGGGACAGGAAGCCAAAAGG - Intronic
1132235352 15:100215979-100216001 TCTTGGGAATGTAAGCCACAGGG + Intronic
1132253000 15:100348784-100348806 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1132358192 15:101189252-101189274 GCACGGGCGTGGAGGCCAGAGGG - Intronic
1133844026 16:9437902-9437924 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1133961940 16:10502374-10502396 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1134350793 16:13436141-13436163 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1134800773 16:17082543-17082565 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1135353337 16:21749025-21749047 TCATGGGAATAGTGGGAAGAAGG + Intronic
1135451824 16:22565148-22565170 TCATGGGAATAGTGGGAAGAAGG + Intergenic
1135820372 16:25679942-25679964 TCCTGGGAATGAAGCCCAGTAGG + Intergenic
1135838773 16:25854558-25854580 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1135957671 16:26969813-26969835 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1136104394 16:28019126-28019148 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1137695351 16:50458131-50458153 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1137853309 16:51767918-51767940 AGCTGGGAATGAAGGCCAGAAGG - Intergenic
1138014874 16:53419263-53419285 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1138257357 16:55577900-55577922 TCAGGGGACCGGAAGCCAGATGG - Intronic
1138569660 16:57861616-57861638 CCATGGTACTGGGGGCCAGAAGG + Intronic
1138779509 16:59765736-59765758 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1138980121 16:62257950-62257972 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1138980269 16:62259333-62259355 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1139280328 16:65764998-65765020 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1139736860 16:68997715-68997737 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1140793674 16:78415468-78415490 TCGTGGGAATGCAGCCCAGTAGG + Intronic
1141343919 16:83228069-83228091 CCGTGAGAAGGGAGGCCAGATGG + Intronic
1142515066 17:422468-422490 TCCTGGGAATTGTGGCCAGAAGG + Intronic
1143378005 17:6478660-6478682 ACAGGGGAAGGGCGGCCAGAGGG + Exonic
1143435211 17:6919453-6919475 TGATGGGAATGAAGGACAGTTGG - Intronic
1144060009 17:11574878-11574900 TCCTGGGAATGCAGCCCAGAAGG - Intergenic
1144273132 17:13639044-13639066 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1144281074 17:13727080-13727102 TCCTGGGAATGCAGTCCAGTAGG + Intergenic
1144494478 17:15737659-15737681 TCATGGGAACAGAGTCCAGCAGG - Intronic
1144905788 17:18639017-18639039 TCATGGGAACAGAGTCCAGCAGG + Intronic
1145866226 17:28243529-28243551 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1145884663 17:28373599-28373621 TCATGGCAACGGATGTCAGATGG - Intronic
1146134001 17:30302439-30302461 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1146297875 17:31664103-31664125 TCATGAGAAAGGAAGTCAGAAGG + Intergenic
1146369585 17:32257097-32257119 TCATGGGCAGGGAAGCCATATGG + Intergenic
1146637819 17:34519086-34519108 TCATTCGAATGGAGGCTAGAAGG + Intergenic
1147755232 17:42762967-42762989 TGCTGGGAATGGAAGCCAGGTGG + Exonic
1147925853 17:43945320-43945342 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1148592355 17:48825890-48825912 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1148792001 17:50178416-50178438 TCATGGGACTGGAGGAGACAGGG - Intergenic
1148933977 17:51149916-51149938 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1149484102 17:57028519-57028541 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
1149922136 17:60669853-60669875 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1150226891 17:63529262-63529284 TAATGGGGAAGGTGGCCAGAGGG + Intronic
1150430866 17:65116033-65116055 TCAGGGCAAAGGAAGCCAGAAGG - Intergenic
1151241541 17:72762147-72762169 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1151950205 17:77348963-77348985 TCATGGGAAATGAGACCAGATGG - Intronic
1152152839 17:78613435-78613457 ACATGCAAATGGAGACCAGATGG - Intergenic
1152208199 17:78987841-78987863 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1152212793 17:79011701-79011723 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1152415992 17:80162343-80162365 TCCTGGGAATGCAGCCCAGTGGG - Intergenic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1152780000 17:82222912-82222934 TCATGTGAATGGAGCCCTGCAGG - Intergenic
1153577472 18:6536978-6537000 TCCTGGGAATGGAGGGCTGAAGG + Intronic
1154489034 18:14904887-14904909 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1155350177 18:24898483-24898505 TCCTGGGAATGCAGACCAGTGGG - Intergenic
1155357103 18:24963944-24963966 TCATGGGCATGCATGCAAGAAGG - Intergenic
1156881526 18:42086433-42086455 TCCTGGGAATGCAGCCCAGTGGG - Exonic
1157741045 18:50093558-50093580 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1157792432 18:50544644-50544666 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1157809548 18:50684857-50684879 CCATAGGGATTGAGGCCAGAGGG + Intronic
1158281923 18:55837957-55837979 TCATGAAAATTGAGTCCAGATGG + Intergenic
1158411699 18:57211238-57211260 TCCTGGGAATGCAGTCCAGTAGG + Intergenic
1158571811 18:58602703-58602725 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1158614163 18:58970559-58970581 TCATGGCAATGGATGCCTCAAGG + Intronic
1158990499 18:62863875-62863897 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1160118296 18:76103084-76103106 AGTTAGGAATGGAGGCCAGAGGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160918610 19:1509488-1509510 TCAGGGAAATGGGAGCCAGAAGG - Intronic
1164518612 19:28958987-28959009 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1164612714 19:29643801-29643823 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1165146112 19:33731628-33731650 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1165158676 19:33803240-33803262 TCAGGGGACAGGAGGCCAGGGGG + Intronic
1165162235 19:33823582-33823604 TCAGGAGACTGGAGGGCAGAAGG + Intergenic
1165708205 19:37991311-37991333 GCATGGAATTGGAAGCCAGATGG - Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166917687 19:46206808-46206830 TCAGGAGAGGGGAGGCCAGAAGG + Intergenic
1167423967 19:49420259-49420281 GGATGAGAATGGAGGCCAGCAGG + Intergenic
1168306142 19:55437390-55437412 TCCTGGGAGGGGAGACCAGAAGG + Intronic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925590257 2:5502270-5502292 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
925853483 2:8107099-8107121 TCCTGGGAATGCAGTCCAGTAGG - Intergenic
925980111 2:9169756-9169778 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
926033602 2:9615476-9615498 TCATGTGGTTGGAGGACAGAGGG + Intronic
926117520 2:10222787-10222809 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
927397723 2:22673567-22673589 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
927892541 2:26761136-26761158 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
928257236 2:29733357-29733379 TAAGGGAAAAGGAGGCCAGATGG + Intronic
928604508 2:32933263-32933285 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
930117173 2:47728143-47728165 TCCTGGGAATGCAGCCCAGCAGG + Intronic
931368524 2:61640543-61640565 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
932076821 2:68672103-68672125 TCTTGGGAATGCAGGCCAGTAGG + Intergenic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932486725 2:72088544-72088566 TCCTGGGAATGCAGACCAGTCGG - Intergenic
932820992 2:74900425-74900447 TCCTGGGAATGCAGTCCAGTAGG + Intergenic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
933071169 2:77859626-77859648 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
933305560 2:80593658-80593680 TCATAGAAATGGAAGGCAGATGG - Intronic
934695448 2:96396855-96396877 TCATGAGAGTGGAGGCCTCATGG + Intergenic
934773374 2:96921915-96921937 TCCTGGGAATGCAGCCCAGTAGG - Intronic
935247854 2:101234797-101234819 TCCTGGGAATGGAGTCCAATAGG - Intronic
935784030 2:106532894-106532916 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
937082165 2:119147932-119147954 TCAAGGGCATGGAGTCCAGTGGG - Intergenic
937099561 2:119258381-119258403 TCCTGGGAATGCAGCCCAGTAGG + Intronic
937274115 2:120673244-120673266 TCAAGGGAAAGGAGACCAGCAGG - Intergenic
937679090 2:124625115-124625137 ACAGGGCAATGCAGGCCAGAGGG - Intronic
938245741 2:129776495-129776517 GCAGGAGACTGGAGGCCAGATGG - Intergenic
938343723 2:130551651-130551673 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
938346110 2:130569071-130569093 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
938781554 2:134589304-134589326 TCCTGGGAATGCAGCCCAGTGGG - Intronic
938802084 2:134772901-134772923 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
938816660 2:134911555-134911577 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
939185228 2:138852806-138852828 TCATGGGAAGGAGGGCAAGAGGG + Intergenic
939292321 2:140212170-140212192 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
940190711 2:151037389-151037411 TCCTGGGAATGCAGCCCAGTAGG - Intronic
940287047 2:152042778-152042800 TCCTGGGAATGCAGCCCAGTAGG - Intronic
941286944 2:163626693-163626715 TCCTGGGAATGCAGCCCAGTAGG - Intronic
941304783 2:163850250-163850272 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
941876811 2:170441949-170441971 TCCTGGGAATGCAGCCCAGTAGG + Intronic
942177915 2:173352892-173352914 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
942925819 2:181430763-181430785 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
943229881 2:185235296-185235318 GCATGGGAATGGTAGCCAGAGGG - Intergenic
943996744 2:194777316-194777338 TCATGGGAATAGAGAGTAGAAGG + Intergenic
944464345 2:199985120-199985142 CCAGAGAAATGGAGGCCAGAGGG + Intronic
944519712 2:200552852-200552874 TCCTGGGAGTGCAGCCCAGAAGG + Intronic
944803520 2:203259374-203259396 TCATGGGAGTGGAGTCCTCATGG + Intronic
945252093 2:207772345-207772367 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
945255333 2:207798489-207798511 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
945877907 2:215297234-215297256 TAATGGAAATGGAGGCAAGGAGG - Intergenic
946440139 2:219688080-219688102 TCTTGGGAATGCAGCCCAGCAGG + Intergenic
947097296 2:226580548-226580570 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
947525654 2:230875257-230875279 TCAAGGACTTGGAGGCCAGAAGG + Intronic
948437597 2:237964634-237964656 TCCTGGGAATGTAGCCCAGTAGG + Intergenic
1168863088 20:1060197-1060219 GCATGGGTATGTAGACCAGAAGG + Intergenic
1169227797 20:3866829-3866851 TGAAGAGAATGGAGACCAGAGGG - Exonic
1169273643 20:4218741-4218763 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1169532189 20:6497158-6497180 TGATGGGAGTGGAAGTCAGAGGG - Intergenic
1169635939 20:7691780-7691802 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1170163403 20:13338467-13338489 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1170210127 20:13839595-13839617 TCATAGTTCTGGAGGCCAGAAGG + Intergenic
1171347877 20:24479504-24479526 GCATGGGAAGGGAAGCCTGAGGG - Intronic
1172170750 20:32930487-32930509 CCATGAGAATGGAGGCCTGCTGG + Intronic
1173293437 20:41734470-41734492 TCTTGGGAATGGAGGGCTAAAGG + Intergenic
1173906854 20:46635691-46635713 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1174105229 20:48157178-48157200 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1174122960 20:48280783-48280805 CCATGGGAAGTGAGACCAGAGGG - Intergenic
1174236034 20:49092663-49092685 GCAGGGGAAGGGAGGGCAGAGGG + Intronic
1174516075 20:51093404-51093426 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1174608373 20:51778275-51778297 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1177174619 21:17690305-17690327 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1177882871 21:26715323-26715345 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1178294051 21:31393828-31393850 TCCTGGAAATGCAGGCCATATGG - Intronic
1178378985 21:32092666-32092688 TCCTGGTTCTGGAGGCCAGAAGG + Intergenic
1178459527 21:32790085-32790107 TGCTGGGAATGCAGGCCAGCAGG + Intergenic
1178469831 21:32882650-32882672 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
1178553957 21:33569720-33569742 CCATGGGACTGGAAGCCTGAGGG + Intronic
1179186186 21:39086883-39086905 GCATTGGAAAGGAGGTCAGAAGG + Intergenic
1181302447 22:21890936-21890958 TTAAAGGCATGGAGGCCAGAAGG + Intergenic
1181451950 22:23028741-23028763 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1181641711 22:24204080-24204102 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1181938693 22:26458009-26458031 TCATGGGGTGGGAGGGCAGAAGG - Intronic
1182087493 22:27571401-27571423 TCAAGGGAACAGAGGCCACAGGG + Intergenic
1182198525 22:28544561-28544583 TCCTGGGAATGCAGCCCAGCCGG - Intronic
1182454736 22:30443069-30443091 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1182782188 22:32877089-32877111 ACATTGGAATTGGGGCCAGAGGG - Intronic
1182939377 22:34260193-34260215 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1183113248 22:35668765-35668787 TCCTGGGAATGCAGCCCAGGAGG - Intergenic
1183325562 22:37189893-37189915 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1183326196 22:37196021-37196043 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1183554430 22:38514212-38514234 TCCTGGGAATGCAGGCCAGTAGG - Intergenic
1183683492 22:39349082-39349104 TCATGGAAACGGAGGCTAGATGG - Intergenic
1184034508 22:41912108-41912130 TCACGGGCATGAAGGACAGATGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184481017 22:44747344-44747366 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
1185099527 22:48830221-48830243 TCCTGGGAAGGGAGGCCCGAGGG + Intronic
949094989 3:75245-75267 TCCTGGGAATGCAGCCCAGTGGG + Intergenic
949779820 3:7673650-7673672 TCATGGAAGTGGATGCCAGCAGG + Intronic
949785289 3:7733605-7733627 TCCTGGGAATGCAGCTCAGAAGG + Intronic
950105653 3:10386684-10386706 TGATGGGATGGGAGGGCAGAGGG + Intronic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
950525028 3:13518490-13518512 TCCCAGGAATGTAGGCCAGACGG + Intergenic
950582520 3:13871846-13871868 TCATGGGAATGGAGACCTTCTGG - Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
950781823 3:15398871-15398893 TCCTGGGAATGCAGCCCAGTAGG - Intronic
950782503 3:15404110-15404132 TCCTGGGAATGCAGCCCAGCAGG + Intronic
951745489 3:25973182-25973204 TCATGGCAAAGGATGACAGATGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951894206 3:27595564-27595586 TCCTGGGAATGTAGCCCAGTAGG + Intergenic
951923111 3:27877386-27877408 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
952179923 3:30906830-30906852 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
952559127 3:34568977-34568999 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
952906973 3:38146220-38146242 TCATGTCAGTGGAGGCCAGATGG + Intergenic
953022218 3:39121973-39121995 TCATGGGATTTGGGGACAGAGGG - Intronic
953074873 3:39559131-39559153 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
953320387 3:41966170-41966192 ACCTGGGAATGCAGCCCAGAAGG - Intergenic
953361593 3:42301872-42301894 TGATGGGAGTGGAACCCAGATGG + Intergenic
953610215 3:44441440-44441462 TCCTGGGAATGCAGCCCAGTAGG + Exonic
954135900 3:48582004-48582026 TCATTGGAATGGAGGTCACATGG + Intronic
954484305 3:50832607-50832629 TCCTGGGAATGCAGCCCAGTAGG + Intronic
956117204 3:65930581-65930603 TCCTGGGAATGCAGCCCAGTAGG - Intronic
956953916 3:74314904-74314926 TCCTGGGAATGCAGTACAGAAGG - Intronic
956962863 3:74423069-74423091 ACATGAGAATGGAGGCAATATGG + Intronic
957038753 3:75319848-75319870 TCATATGAATGGAGGCTACATGG + Intergenic
957121233 3:76096232-76096254 GCATGAGAATGTAGGTCAGAAGG - Intronic
957179450 3:76858044-76858066 TCCAGGGAATGGGGGCCATAAGG - Intronic
958037997 3:88192433-88192455 TCATGGGAATGCAGCCCAGTAGG + Intergenic
958038409 3:88196301-88196323 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
958890493 3:99777118-99777140 TCCTGGGAATGCAGCCCAGTAGG + Intronic
959053439 3:101546377-101546399 TCCTGGGAATGCAGTCCAGTAGG + Intergenic
960069157 3:113409675-113409697 TCCTGGGAATGCAGCCCAGTAGG - Intronic
960504721 3:118478880-118478902 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
960704588 3:120469669-120469691 TCTTGGGAATGCAGCCCAGCAGG - Intergenic
960719517 3:120611986-120612008 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
960748905 3:120924282-120924304 TCATGTGAATGAATGCTAGAGGG + Intronic
961086788 3:124075148-124075170 TCATATGAATGGAGGCTACATGG + Intergenic
961436096 3:126917736-126917758 TCATGGGAGTGGAGGCCTCATGG + Intronic
961645198 3:128389115-128389137 CCATGGGGATGGAGGCTGGAGGG + Intronic
961755212 3:129122796-129122818 TGATGGGAAGCTAGGCCAGAAGG + Intronic
962292038 3:134145410-134145432 TCAGGGGAGTGGAGGGCAGGGGG + Intronic
963043434 3:141085420-141085442 CTATGGGAATGGAAGCCACAAGG - Intronic
963887670 3:150599995-150600017 TCCTGGGAATGCAGCCCAGCAGG + Intronic
963983063 3:151562044-151562066 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
964382373 3:156110346-156110368 TTATGGCAATGTAGGCCTGAGGG - Intronic
965895417 3:173570085-173570107 TCTTGGGAGTGGGGGCCAGAAGG + Intronic
966097578 3:176222870-176222892 TTATGGGAATGAAGACCACAAGG - Intergenic
966382203 3:179355337-179355359 TCCTGGGAATGCAGCCCAGTAGG + Intronic
967601167 3:191390817-191390839 TCCTGGGAATGGAGTCCAGTAGG + Intronic
968042845 3:195602219-195602241 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
969504383 4:7575098-7575120 TTATGGCAATGAAGCCCAGAGGG - Intronic
970204478 4:13642492-13642514 TAATGAGCATGGGGGCCAGATGG - Intergenic
970221137 4:13812292-13812314 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
973640963 4:52902177-52902199 TCACAGGAATGGAGGTCAGCAGG - Intronic
973775596 4:54238569-54238591 TCCTGGGAATGCAGCCCAGCAGG - Intronic
973777392 4:54256006-54256028 TCCTGGGAATGCAGCCCAGCAGG - Intronic
974022110 4:56700926-56700948 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
974027300 4:56744898-56744920 TGATGGGACAGGAGGCCAGATGG + Intergenic
974855561 4:67456756-67456778 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
974922978 4:68265108-68265130 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
976004832 4:80417384-80417406 TCCTGGGAATGCAGCCCAGGAGG + Intronic
976638342 4:87310872-87310894 TCCTGGGAATGCAGCCCAGTAGG - Intronic
977615542 4:99084194-99084216 TCCTGGGAATGCAGCCCAGTAGG - Intronic
978328581 4:107586959-107586981 TCAGGGGAAGGGAACCCAGAAGG - Intergenic
978520399 4:109609586-109609608 TCCTGGGAATGTAGTCCAGCAGG + Intronic
978568163 4:110106750-110106772 TCCTGGGAATGCAGCCCAGTAGG + Intronic
978711414 4:111787141-111787163 TGATTCGAATGGAGGCCACATGG - Intergenic
979067496 4:116156821-116156843 TCTTGGGAATGCAGCCCAGTAGG + Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
982748400 4:159130296-159130318 TCCTGGGAATGCAGTCCAGTAGG + Intronic
983044740 4:162972785-162972807 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
983081001 4:163385646-163385668 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
983771498 4:171555348-171555370 TCCTGGGAATGAAGCCCAGTAGG + Intergenic
983995437 4:174176124-174176146 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
984601190 4:181728769-181728791 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
984706644 4:182851965-182851987 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
984872553 4:184339854-184339876 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
986266504 5:6195894-6195916 TCCTGGGAATGCAGCCCAGGAGG + Intergenic
986454555 5:7903351-7903373 TCCTGGGAATGCAGCCCAGTAGG + Intronic
986903332 5:12463945-12463967 ACATGAGGATGGAGGCCAGGAGG + Intergenic
988087207 5:26487440-26487462 TCTTGGGAATGCAGCCCAGTAGG + Intergenic
988299586 5:29404662-29404684 TCATAGTAATGGTGGCCATAGGG + Intergenic
988453029 5:31362268-31362290 TCCTGGGAATGCAGCCCAGAAGG + Intergenic
988781017 5:34521906-34521928 TCAGGAGAATGGAGGGCAGGAGG - Intergenic
989153924 5:38326199-38326221 TCATAGCAGTGGAAGCCAGAGGG - Intronic
989229224 5:39067364-39067386 CCATGGGAATGGATCCCTGATGG - Intronic
990245542 5:53859980-53860002 TCATTGGAATGAAGTCCCGAGGG + Intergenic
991083343 5:62624636-62624658 TCCTGGGAATGCAGCCCAGTAGG + Intronic
994688520 5:102987393-102987415 TCAGGGGAATGGAGACAAGTTGG + Intronic
995874776 5:116778844-116778866 TCAGGGGAAGGGAGACCAGAGGG - Intergenic
996796402 5:127353001-127353023 TCTTGGGAAAGGAGGCCTAATGG - Intronic
996998457 5:129727901-129727923 TCCTGGGAATGCAGCCCAGTAGG - Intronic
997320238 5:132972053-132972075 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
997829546 5:137138176-137138198 ACCTGGGAATTGAGCCCAGATGG + Intronic
998136987 5:139679075-139679097 TCAAGGGAATGGAGCCCAGCAGG - Intronic
998328803 5:141305291-141305313 TCCTGGGAATGCAGTCCAGTAGG - Intergenic
998396079 5:141818937-141818959 CAATGGGATTGGAGGCCAGTGGG + Intergenic
998511687 5:142719039-142719061 TCATAGGAAGTGAGGCAAGATGG + Intergenic
998982935 5:147724922-147724944 TCCTGGGAATGCAGTCCAGTAGG - Intronic
999202259 5:149824786-149824808 CCCTGGGGATGGAGGCCCGAGGG - Intronic
1000138673 5:158380458-158380480 TTCAGGGAATGGAGGCCAAAGGG + Intergenic
1000246124 5:159449834-159449856 CCATGGGAATGGATGCGGGAGGG + Intergenic
1000311021 5:160044780-160044802 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1001144329 5:169170553-169170575 TGATGGGAATGGAAGCAAGCTGG + Intronic
1001339471 5:170830114-170830136 TCCTGGGAATGAAGCCCAGTAGG - Intergenic
1001358307 5:171054689-171054711 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1002904514 6:1438012-1438034 TGATGGGAATGGAGACCCGAAGG - Intergenic
1003372490 6:5542204-5542226 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1003567210 6:7231288-7231310 TCTGGGCAATGGAGGCCAGCGGG - Exonic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1003855865 6:10273924-10273946 TAATGTGAGTGGAGGCCACAGGG + Intergenic
1004366761 6:15019486-15019508 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1004467106 6:15896186-15896208 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1004478412 6:15996127-15996149 TCATGGGCCTGGAGACCAGAAGG + Intergenic
1004552797 6:16665645-16665667 TTATGGAAATTGAGGCCAGAAGG - Intronic
1004608986 6:17220775-17220797 TCCTGGGAATGCAGCCCAGGAGG + Intergenic
1004934157 6:20491423-20491445 TCCTGGGAATGGAAGCACGATGG - Exonic
1005018851 6:21398898-21398920 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1005292842 6:24396198-24396220 TCAAGGGAATGGCAACCAGATGG - Intergenic
1005449753 6:25961368-25961390 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1005615495 6:27568567-27568589 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1005983415 6:30854844-30854866 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1006793184 6:36716758-36716780 TCATGAGGATGGATGCCAGAGGG - Intronic
1007156861 6:39753336-39753358 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1007169760 6:39854247-39854269 TCATGGAAAAGGAGGAAAGAGGG - Intronic
1007323713 6:41044475-41044497 GCATGTGAATGGAGGCGAGCTGG - Intronic
1007523564 6:42471040-42471062 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1008189727 6:48439629-48439651 TCATGGGAGTGGATGCCTCAGGG + Intergenic
1008237190 6:49064645-49064667 TCATGGGAATGGATTCCTCACGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010153525 6:72764797-72764819 TCATGGACATGGAGACTAGAAGG - Intronic
1011292625 6:85792531-85792553 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1011299943 6:85863418-85863440 TCAGGGGGATGGAGCCAAGATGG - Intergenic
1011595145 6:89008888-89008910 TCCTGGGAATGTGGCCCAGAAGG + Intergenic
1012211134 6:96520466-96520488 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1012290688 6:97452101-97452123 TCATGAGAATGGAGCCCTCATGG + Intergenic
1013281930 6:108646125-108646147 CCATCCGAATGGAGGCCAAAAGG + Intronic
1013476243 6:110509879-110509901 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1013523475 6:110953890-110953912 TCATGGGAATGCAGCCCAGTAGG - Intergenic
1014351769 6:120354567-120354589 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1014667977 6:124262877-124262899 TCAAGGTCATGGAGACCAGAAGG - Intronic
1015838422 6:137448457-137448479 TCATGAGAAGGTAAGCCAGAGGG - Intergenic
1016233977 6:141839086-141839108 ACATGGGGCTGGAGGCAAGAGGG + Intergenic
1016513938 6:144872977-144872999 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1017388203 6:153909926-153909948 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1017392875 6:153959992-153960014 TCCTGGGAATGAAGCCCAGTAGG - Intergenic
1017406389 6:154123969-154123991 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1017637269 6:156455878-156455900 TCACAGGTCTGGAGGCCAGAGGG + Intergenic
1017814059 6:158004214-158004236 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1018078562 6:160238947-160238969 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1018454624 6:163940927-163940949 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1018611927 6:165655203-165655225 TCATGGGATTGGATGCCCCAAGG - Intronic
1018672987 6:166194922-166194944 TCATGGGGACAGAGGCCAGGAGG + Intergenic
1019730792 7:2628314-2628336 TCACGGTTCTGGAGGCCAGAAGG + Intergenic
1019951341 7:4375523-4375545 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1019978803 7:4605893-4605915 TCATGGGACTGCAGGACACAGGG + Intergenic
1020538901 7:9436389-9436411 TCATGGGGGTGGAGCCAAGATGG + Intergenic
1021018973 7:15572759-15572781 TCATGAGGGTGGAGGCCACATGG - Intergenic
1021309819 7:19080188-19080210 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1022098299 7:27154529-27154551 TCCTGGGAATGGAGGCCCTCTGG + Exonic
1023197789 7:37660828-37660850 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1023588018 7:41751144-41751166 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1023603774 7:41908643-41908665 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1024039919 7:45544711-45544733 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1024140621 7:46459811-46459833 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1024433808 7:49324470-49324492 TCCTGGGAATGGAGGCCAGTAGG + Intergenic
1024678335 7:51658275-51658297 CCATGGGAATGGTGCCCAGCAGG - Intergenic
1024705854 7:51959132-51959154 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1025005396 7:55350444-55350466 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1025026981 7:55524745-55524767 TGATGGGAATGGAGACCAGGAGG + Intronic
1025146952 7:56513550-56513572 CCATTGGAATGGAGGAGAGATGG - Intergenic
1025849415 7:65233744-65233766 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1026119515 7:67524638-67524660 TCCTGGGAATGCAGCCCAGTGGG + Intergenic
1026123808 7:67561830-67561852 TTCTGGGAATGGAGCCCAGCAGG - Intergenic
1026493050 7:70879801-70879823 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1026583658 7:71638347-71638369 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1026625690 7:71990023-71990045 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1026677303 7:72438532-72438554 TCATGGGAAGGGAGAAAAGATGG - Intronic
1026921657 7:74160104-74160126 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1027160978 7:75801927-75801949 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1027228046 7:76257112-76257134 TCCTGGGAATGCAGACCAGTAGG + Intronic
1027796227 7:82696833-82696855 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1028228269 7:88275055-88275077 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1030735023 7:113037774-113037796 TTAGGGGAATGGAGCCCAGGAGG + Intergenic
1032056986 7:128691494-128691516 TCCTAGGAATGGAGCCCAGTAGG - Intergenic
1032136140 7:129280015-129280037 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1032986801 7:137346191-137346213 TCCTGGGAATGAAGCCCAGTAGG + Intergenic
1033465879 7:141589065-141589087 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1033718865 7:144035582-144035604 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1034788465 7:153946615-153946637 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1035208287 7:157309207-157309229 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1035924885 8:3716681-3716703 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1035955174 8:4069609-4069631 TGAGGGGAATACAGGCCAGATGG - Intronic
1036459887 8:8942652-8942674 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1037012021 8:13855527-13855549 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1038338851 8:26667293-26667315 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1039004925 8:33025028-33025050 TCATCAGCATGGAGGCCAAAAGG - Intergenic
1039071780 8:33655454-33655476 TCATGGGAATAGAGAATAGAAGG - Intergenic
1039287534 8:36058592-36058614 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1039438115 8:37575186-37575208 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1039604110 8:38866743-38866765 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1039642001 8:39233610-39233632 TCCTGGGAATGCAGCCCAGTAGG + Intronic
1039861068 8:41458223-41458245 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1039882101 8:41631380-41631402 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1041068828 8:54106554-54106576 TCGTGGGAATGCAGCCCAGCGGG + Intergenic
1041924695 8:63224511-63224533 TCCTGGGAATGCAGCCCAGTTGG + Intergenic
1042727095 8:71890068-71890090 TCATGGGAATACAGCCCAGTAGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1042987644 8:74602056-74602078 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1045282929 8:100765234-100765256 TCCTGGGAATGTAGCCCAGTAGG - Intergenic
1045290508 8:100828649-100828671 TCCTGGGAATGCAGCCCAGTGGG - Intergenic
1045481526 8:102596743-102596765 TCTTGGGACTGAAGGCCAGTGGG - Intergenic
1047389957 8:124442377-124442399 TCCTGGGAATGGAATCCAGCAGG + Intergenic
1048867233 8:138770037-138770059 GTATGGACATGGAGGCCAGAGGG + Intronic
1049360853 8:142212000-142212022 GGATGGGAATGGAGGCCAACAGG - Intergenic
1049795106 8:144493633-144493655 TCCTGGGCAGGGAGGCCAGAGGG + Intronic
1049853178 8:144845267-144845289 TCATGGGAATGGTGGGCAAAAGG - Intronic
1050141928 9:2525044-2525066 TCCTGGGAATGAAGCCCAGCAGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050834015 9:10052840-10052862 CCATAGGAATGGAGGTGAGATGG - Intronic
1052427484 9:28324418-28324440 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1052480526 9:29019512-29019534 TAGTGGGAGTGGAGACCAGAAGG - Intergenic
1053009995 9:34627725-34627747 TCGTGGGGATGGAGTCCAGGGGG + Exonic
1053228727 9:36386567-36386589 TGATGGGAATGCAGCCCAGCAGG - Intronic
1054143221 9:61544495-61544517 TCCTGGGAATGCAGGCCGGCAGG - Intergenic
1054744114 9:68836935-68836957 TCATGGAAATGGAAGCCTGAGGG - Intronic
1054857550 9:69916832-69916854 TAATGGGAATGAAGCCCAGTAGG + Intergenic
1055348338 9:75359740-75359762 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1056010176 9:82320953-82320975 ATGTAGGAATGGAGGCCAGAAGG - Intergenic
1056396200 9:86183606-86183628 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1057007018 9:91569231-91569253 TCAAGGGCATGGAGCCCAGGGGG - Intronic
1057333340 9:94137177-94137199 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1057358578 9:94352488-94352510 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1057649173 9:96905122-96905144 TCCTGGGAATGCAGCCCAGCAGG - Intronic
1057780956 9:98049784-98049806 TCATGGGAATGCAGCTCAGAAGG + Intergenic
1057888752 9:98852110-98852132 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1057943100 9:99301977-99301999 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1058356099 9:104084863-104084885 TCCTGGGAATGCAGCCCAGTGGG + Intergenic
1058914389 9:109551659-109551681 TGATGGGAGAGGAGGCTAGAGGG - Intergenic
1058927815 9:109685147-109685169 TCATAGGAATGGAGTGCAAAGGG + Intronic
1060192840 9:121603945-121603967 TTATGGGAATGGTGGCCAGTGGG + Intronic
1060496688 9:124124697-124124719 CCAGGAGAAAGGAGGCCAGAGGG - Intergenic
1060499340 9:124141150-124141172 TCCTGGGAATGCAGTCCAGGAGG - Intergenic
1060808139 9:126591399-126591421 TCATGGTAATGGATGCTAGACGG + Intergenic
1061407053 9:130398299-130398321 TGATGGGAGTGGAGGCCTGGAGG + Intronic
1061636035 9:131908918-131908940 TCCTGGGAATGCAGCCCAGAAGG + Intronic
1061936851 9:133862672-133862694 TCATAGGAACGGAGCCCAGAGGG + Intronic
1062222684 9:135426308-135426330 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1062393774 9:136344381-136344403 TCACGGCTCTGGAGGCCAGAAGG + Intronic
1185749450 X:2599105-2599127 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1185785797 X:2889974-2889996 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1185819206 X:3185360-3185382 TCCTGGGAATGCAGTCCAGCAGG + Intergenic
1185823585 X:3227713-3227735 TCCTGGGAATGCAGTCCAGTAGG - Intergenic
1185849298 X:3470348-3470370 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1185859781 X:3566833-3566855 TCCTGGGAATGCAGCCCAGTGGG + Intergenic
1185860141 X:3570875-3570897 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1185929099 X:4182195-4182217 TCCTGGGAATGCAGCCCAGCAGG + Intergenic
1186089054 X:6024471-6024493 TCTTGGGAATGCAGCCCAGTAGG - Intronic
1187140225 X:16586137-16586159 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1187306511 X:18099917-18099939 TCTTGGGAATGCAGCCCAGCAGG - Intergenic
1187585947 X:20662068-20662090 ACATGGGAATTGTGGCCAAAAGG - Intergenic
1187748581 X:22435431-22435453 TCATGCAAATGGACGCCAAAAGG + Intergenic
1188126587 X:26375567-26375589 TCTTGGGAATGCAGCCCAGTAGG + Intergenic
1188213155 X:27446941-27446963 TCCTGGGAATGCAGCCCAGTGGG + Intergenic
1188626319 X:32289483-32289505 TCCTGGGAATGCAGCCCAGTAGG - Intronic
1188955010 X:36423881-36423903 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1189072865 X:37883380-37883402 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1190137446 X:47809530-47809552 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1190465468 X:50721650-50721672 TCCTGGGAATGCAGCCCAGCAGG + Intronic
1190728910 X:53211727-53211749 TCATAGGTATTGATGCCAGATGG - Intronic
1191704199 X:64076484-64076506 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1191822870 X:65332057-65332079 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192498257 X:71630970-71630992 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1193903806 X:87218054-87218076 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1194422410 X:93692899-93692921 TCATGGAAATATAGGGCAGAAGG + Intronic
1195596700 X:106699301-106699323 GCATGGTAATGCAGGGCAGAAGG - Intronic
1195736259 X:108016026-108016048 TCAAGGGAATGGATGCTAGATGG - Intergenic
1195876853 X:109550969-109550991 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1195877312 X:109555494-109555516 TCCTGGGAATGCAGCCAAGAAGG - Intergenic
1195953493 X:110303546-110303568 TAATGGGATAGGAGGCCAAATGG - Intronic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1196371473 X:114984211-114984233 AAAGGGGAATGGAGGCAAGATGG + Intergenic
1196421929 X:115531705-115531727 TAAAGAGAATGGAGGTCAGAAGG + Intergenic
1197283162 X:124561906-124561928 TCATCTGAATGGGGCCCAGATGG - Intronic
1197408916 X:126091921-126091943 TCATGGAAATGGAGAGTAGAAGG + Intergenic
1197738994 X:129874827-129874849 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1198054986 X:132984995-132985017 TCATTGGAAAGCAGGCCAGAAGG - Intergenic
1198301449 X:135337805-135337827 TCATTGGAAAGCAGGCCAGTAGG + Intronic
1198454747 X:136805507-136805529 TCTTGGGAATGCAGCCCAGTAGG - Intergenic
1198762106 X:140043026-140043048 GCAAGGGAATGGAGGCAAGTGGG - Intergenic
1198832940 X:140770180-140770202 TCCTGGGAATGCAGCCCAGTAGG - Intergenic
1198847015 X:140923252-140923274 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1198966544 X:142233102-142233124 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199404552 X:147441969-147441991 TCCTGGGAATGAAGCCCAGTAGG - Intergenic
1199461184 X:148087274-148087296 TCATGAGAATGGAGTCCTCATGG + Intergenic
1199486755 X:148356885-148356907 TCATGAGAGTGGAGCCCACATGG + Intergenic
1199948485 X:152686479-152686501 TCCTGGGAATGTAGCCCAGTAGG - Intergenic
1199961194 X:152781977-152781999 TCCTGGGAATGTAGCCCAGTAGG + Intergenic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic
1201255832 Y:12107462-12107484 TCCTGGGAATGCAGCCCAGTAGG + Intergenic
1201288060 Y:12395846-12395868 TCCTGGGAATGCAGCCCAGCAGG - Intergenic
1202023435 Y:20492390-20492412 TCCTGGTAGTGGAGGCCACAGGG + Intergenic
1202302156 Y:23428187-23428209 TCTTGGGAATGCAGCCCAGTAGG + Intergenic
1202568655 Y:26242411-26242433 TCTTGGGAATGCAGCCCAGTAGG - Intergenic