ID: 958699825

View in Genome Browser
Species Human (GRCh38)
Location 3:97574294-97574316
Sequence ATGTGGTAGTTGAATGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958699824_958699825 -7 Left 958699824 3:97574278-97574300 CCATAAGTGCTGTAATATGTGGT 0: 1
1: 0
2: 0
3: 16
4: 89
Right 958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG 0: 1
1: 0
2: 1
3: 28
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958699825 Original CRISPR ATGTGGTAGTTGAATGAAAG AGG Intronic
901327604 1:8377858-8377880 AGGTGATAATTGAATGACAGGGG + Intronic
902219121 1:14953483-14953505 ATGGGGAAGTTGAATCACAGAGG - Intronic
903507339 1:23847027-23847049 ATTTGGTAGATAATTGAAAGGGG - Intronic
903753969 1:25647805-25647827 ATGTGTGAGTTGAATGCATGTGG + Intronic
904048837 1:27626015-27626037 ATGTGGTGGCTGAGTGAGAGTGG + Intronic
904221411 1:28972986-28973008 ATGTGGTCTTTGGATGAAAATGG - Intronic
904516301 1:31058215-31058237 ATGTTGTAGTTGAAAGTAGGGGG - Intronic
905302110 1:36992455-36992477 TTCTGGTGGTTGAATGACAGAGG + Intronic
908482142 1:64552090-64552112 ATCTGTTACTTGAAGGAAAGTGG - Intronic
908580539 1:65511660-65511682 AAGAGGTAGTTGAATGAACAGGG + Intronic
908914568 1:69111120-69111142 ATGTGGAATTTGAATGAGACTGG + Intergenic
910897755 1:92085996-92086018 ATGTAGGGGTTGAAAGAAAGTGG + Intronic
911364595 1:96921664-96921686 AAGTGGTAGGTGAATAAAAGTGG + Intergenic
911389493 1:97221252-97221274 ATGTGCTAGCAAAATGAAAGAGG - Intronic
912921799 1:113875472-113875494 AAGTGGTAGTAGAACGAACGAGG - Intergenic
913499314 1:119456299-119456321 ATGTGGCAGAAGAATGGAAGGGG + Intergenic
914227636 1:145734538-145734560 ATTTGTTAGATGAATGAAAGAGG - Intronic
914293940 1:146301279-146301301 GTGGGGTAGTTGAATAAAATTGG + Intergenic
914554984 1:148752062-148752084 GTGGGGTAGTTGAATAAAATTGG + Intergenic
915788209 1:158639258-158639280 ATCTGGTATTTGAAAGAAAGTGG - Intronic
916300299 1:163266303-163266325 AGGTAGTAGTGGAATGAATGTGG - Intronic
916820009 1:168388945-168388967 ATGTGGGAGAAGAAAGAAAGTGG + Intergenic
920059078 1:203215237-203215259 ATGTGGTGGCTGACTGGAAGAGG + Intronic
921838046 1:219798396-219798418 ATGTGCTAATGGAAAGAAAGAGG + Intronic
922948727 1:229539673-229539695 CTGTGACAGTTGAATGAAAAAGG - Intronic
924009275 1:239646865-239646887 ATGTGGAAATTGACTGAAGGTGG + Intronic
924075059 1:240325036-240325058 CTGTGGTTGTAGAATGAAAAGGG + Intronic
924876038 1:248105525-248105547 ATGTGGGGGTTGAAAGAAAGTGG + Intergenic
1063621197 10:7650760-7650782 ATGTTGTTATTGAATGAAACAGG + Intronic
1064415618 10:15146768-15146790 ATGTGTTAGTTGTATGAGACTGG - Intronic
1065342356 10:24719917-24719939 ATGTGGAAGTGGAAATAAAGGGG - Intronic
1066704202 10:38159835-38159857 ATGTGGGGGTTGAAAGGAAGTGG + Intergenic
1066986418 10:42472040-42472062 ATGTGGGGGTTGAAAGGAAGCGG - Intergenic
1067493296 10:46735641-46735663 ATGTGGTACTTTGATGACAGTGG - Intergenic
1067601365 10:47604763-47604785 ATGTGGTAATTTGATGACAGTGG + Intergenic
1070892851 10:79954985-79955007 ATGTGGGGGTTGAAAGGAAGTGG - Intronic
1070943415 10:80367417-80367439 ATGTGGGAGTTGAAAGAAAGTGG + Exonic
1072393323 10:95012605-95012627 ATGTGGCAGTAGAAAGAATGAGG - Intergenic
1072967627 10:99987859-99987881 ATGTGGTAGTTGATATAAACTGG + Intronic
1073986674 10:109217502-109217524 ATGGGGTAGTGGAAGGAAGGGGG - Intergenic
1077877413 11:6320002-6320024 GTGTGGTAGGTGGATGGAAGCGG + Intronic
1078328061 11:10396568-10396590 ATGTGGCAGATGAAGGAAAGAGG + Intronic
1078339419 11:10488389-10488411 GTGTGGTAGGGGAATGGAAGTGG + Intronic
1079483761 11:20912007-20912029 ATGTGGTTGTTGAATCCATGAGG - Intronic
1079568174 11:21908938-21908960 ATGTGGTAATTTAATGAAATGGG + Intergenic
1080046516 11:27814292-27814314 ATGTGTTAGTTGAGGGGAAGTGG + Intergenic
1080866166 11:36197210-36197232 ATGAGGCAGCAGAATGAAAGAGG - Intronic
1080943903 11:36949833-36949855 ACATGGTAGTTGCATGGAAGAGG - Intergenic
1081765705 11:45608579-45608601 TTGTGGAACTGGAATGAAAGTGG - Intergenic
1082062142 11:47870157-47870179 TTGTGGCAGTTGAGTGAAACTGG - Intergenic
1087145105 11:94802902-94802924 ATGTGTCAGTGAAATGAAAGGGG - Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087409801 11:97777231-97777253 ATGTGGTACTTTAATGCAAAGGG + Intergenic
1087473607 11:98608101-98608123 CTGTAGTAGTTGAATGCATGAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089805400 11:121083285-121083307 AAGTGGTAATTGATTGAATGTGG + Intronic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1094674898 12:32610224-32610246 ATTTGGCAGATGAATGAAATGGG - Intronic
1095518516 12:43034500-43034522 AGGTGGAAGTTGAATTGAAGGGG - Intergenic
1095856469 12:46865517-46865539 ATGTTGTAGTTGAGTGACTGTGG + Intergenic
1096923577 12:55116759-55116781 ATGTTGTATTTTAATGAATGAGG - Intergenic
1096949012 12:55444928-55444950 AAATGGTATTTGCATGAAAGAGG + Intergenic
1098208244 12:68135292-68135314 ATCTGGTTGTGGAATGATAGTGG + Intergenic
1098749597 12:74277643-74277665 ATGTTGTAGTTGAGTGACTGTGG - Intergenic
1098814679 12:75143440-75143462 GTGTGGCAGCTGAATGAAAGAGG - Intronic
1099319952 12:81133562-81133584 ATGTAGAAGTTGAAAAAAAGTGG - Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099540137 12:83897781-83897803 ATGGGGTGGTGGAATGGAAGAGG + Intergenic
1099565819 12:84245003-84245025 AAGAGGTAGTGGAATGAGAGTGG + Intergenic
1100038762 12:90284779-90284801 AAGTGGTATTTCAATGAAAGGGG + Intergenic
1100311758 12:93401942-93401964 GTGGGGTAGTTGAATAAAATTGG + Exonic
1101141102 12:101796985-101797007 ATGGGGTAGCGGAATCAAAGAGG + Intronic
1101654110 12:106704994-106705016 ATGTGGTACTTTCATCAAAGTGG + Intronic
1103458285 12:121084481-121084503 GTGGGGCATTTGAATGAAAGTGG + Intergenic
1104163024 12:126199044-126199066 ATGTGGAATTTTAATGAAAAGGG + Intergenic
1104575945 12:129965960-129965982 ATGTGAAAGTTGCAGGAAAGTGG + Intergenic
1106313889 13:28577130-28577152 ATGTGGGAGGTGAATGAGAGGGG + Intergenic
1107174349 13:37382641-37382663 ATATGGTAATTTTATGAAAGCGG + Intergenic
1109187593 13:59289092-59289114 ATATAGTATTTGAATGATAGGGG - Intergenic
1109857087 13:68145106-68145128 AAGTGGTACTTGAAAGGAAGGGG - Intergenic
1109888334 13:68573549-68573571 GTATGGTAATTGAAAGAAAGAGG + Intergenic
1110829786 13:80017889-80017911 ATGTGCTAAATGAATGAATGAGG - Intergenic
1115073703 14:29359311-29359333 CTGGGGAAGTTGAATGATAGAGG + Intergenic
1115257008 14:31413825-31413847 ATGAAGTAGTTGAAAGAATGTGG - Intronic
1116127830 14:40811980-40812002 AGGTTCTAGTAGAATGAAAGTGG + Intergenic
1116248923 14:42456427-42456449 ATTTTGTAGTTGAATGACTGTGG - Intergenic
1116438758 14:44925820-44925842 ATGTTGTAATAGAATGTAAGTGG - Exonic
1117451402 14:55853580-55853602 ATGTGGGAGTTGAAGGAATGGGG - Intergenic
1120368852 14:83606761-83606783 TTGTGGTAGTTGAAAGAGATGGG - Intergenic
1120911211 14:89668756-89668778 ATGGGGTAGTGGAATGAATAGGG - Intergenic
1124228505 15:27918523-27918545 ATGTGGACGTTAATTGAAAGAGG - Intronic
1125973789 15:43933621-43933643 ACGTGGAAGGTTAATGAAAGTGG - Intronic
1126961073 15:53995217-53995239 ATTTGGTAGTTAGAAGAAAGGGG + Intergenic
1127014433 15:54667528-54667550 ATGTGGGAGTAGACTAAAAGAGG - Intergenic
1127965107 15:63917477-63917499 ATGGGAGAGATGAATGAAAGAGG + Intronic
1129530818 15:76263117-76263139 ATGTGGGGGTTGAAAGGAAGTGG - Intronic
1129823944 15:78622005-78622027 ATGTGGGGGTTGAAAGGAAGCGG + Intergenic
1131807570 15:96138417-96138439 AGGAGGTAGTTGAATCATAGGGG - Intergenic
1135074349 16:19380727-19380749 ATTTGGTGATTGAATGAAGGAGG - Intergenic
1137537829 16:49340879-49340901 CTTTGGTAATTGAAGGAAAGGGG - Intergenic
1137668002 16:50262871-50262893 TTGGGGGAGTTGAAAGAAAGCGG + Intronic
1138125985 16:54438926-54438948 ATGAAGTAATTGAATGAATGAGG + Intergenic
1138838786 16:60472202-60472224 TTGTGGTAGTTGTCTGCAAGTGG + Intergenic
1139933360 16:70548098-70548120 ATATTGTACTTGAAGGAAAGGGG + Intronic
1140468651 16:75202246-75202268 ATGCATTAATTGAATGAAAGGGG + Intergenic
1144690160 17:17256411-17256433 ATGGGGGAGTTAAATAAAAGAGG + Intronic
1144995282 17:19263877-19263899 CTGTGGTGGCTGAAGGAAAGAGG + Intronic
1146750637 17:35374804-35374826 AGGTGGTCATTGAAAGAAAGTGG - Intergenic
1149794977 17:59510725-59510747 ATTTGGTTGTTGAATGGAGGGGG + Intergenic
1150752232 17:67875471-67875493 ATTTAGTAGTTGACTGAATGTGG + Intronic
1150968258 17:69996646-69996668 ACATGGTTGTTGAATGAATGAGG + Intergenic
1159744550 18:72214879-72214901 ATGTGGATGGTGAATGAACGTGG - Intergenic
1164142073 19:22479186-22479208 GTATGGTACTTGAATAAAAGTGG - Intronic
1164709532 19:30345504-30345526 ATGTGGTAATAGCATGAAGGTGG + Intronic
1164790463 19:30973267-30973289 ATGTGCTATCTGATTGAAAGTGG + Intergenic
1164835501 19:31352770-31352792 ATGGGGGAGTTGAAGGCAAGAGG - Intergenic
1165437476 19:35804113-35804135 ATGCTGTAGTTGAAGGAGAGGGG - Intronic
1167753782 19:51397528-51397550 ATGTGGGGGTTGAAAGAAAGTGG + Intergenic
925453210 2:3989859-3989881 AGGAGGTAGTTGAATCACAGGGG - Intergenic
925460478 2:4058622-4058644 ATTTTGTAGTTGAATGACTGTGG - Intergenic
925700810 2:6635976-6635998 ACATGGTAGTTGAGGGAAAGAGG - Intergenic
926405926 2:12552607-12552629 AAGTGGTAGTTGATTGGGAGAGG + Intergenic
926471572 2:13266145-13266167 CTCTGTTAGTTGAATGAAACTGG - Intergenic
926939831 2:18123691-18123713 ATCTGAGATTTGAATGAAAGGGG + Intronic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
928806794 2:35167968-35167990 ATGTGGCAGTAGAGTGAAAATGG - Intergenic
929324881 2:40597376-40597398 ATGTTGTTGTTAAATGAAAAAGG + Intronic
935722267 2:105990042-105990064 ATGTGGGGGTTGAAAGGAAGTGG - Intergenic
935722794 2:105994597-105994619 ATGTGGGGGTTGAAAGGAAGTGG - Intergenic
936676821 2:114725350-114725372 AGGTGGTAGGTGATGGAAAGTGG - Intronic
937140143 2:119593231-119593253 ATGTGGTATTTGCATGAGTGTGG + Intronic
938911343 2:135888290-135888312 ATGTGGGGGTTGAAAGGAAGCGG + Intergenic
940289854 2:152067839-152067861 TTGTGGTACTTGAATGACATAGG + Intronic
943688801 2:190847969-190847991 GTGTGGTATTTTAATAAAAGAGG - Intergenic
943968282 2:194367359-194367381 ATGTGGGGGTTGAAAGAAAGCGG + Intergenic
945405793 2:209447299-209447321 ATTTGGTAGTTCTGTGAAAGTGG - Intronic
945544342 2:211131258-211131280 GACTGGTAGTTGAATGAAACAGG - Intergenic
945544632 2:211136320-211136342 ATGTTGTAGTTGAGTGACTGTGG - Intergenic
945875226 2:215271430-215271452 ATCTGGTAGTAGAATGAATATGG - Intergenic
948389713 2:237603129-237603151 AGGTGGTGGTGGAGTGAAAGAGG + Intergenic
1169995578 20:11552607-11552629 ATGTGATACCTGAATGAAATGGG - Intergenic
1170421706 20:16199904-16199926 ATGTGGTAGCTGACTGAATCAGG - Intergenic
1171749661 20:29036515-29036537 ATGTGGTTGTTGCCTGGAAGGGG + Intergenic
1173195090 20:40907708-40907730 AGGTTGCAGTTGAAAGAAAGTGG - Intergenic
1174172342 20:48625480-48625502 ATGTGGACGTTGAAGGAAACCGG + Exonic
1174574629 20:51527609-51527631 ATGTGTTGGCTGAATGAATGAGG + Intronic
1174813410 20:53666429-53666451 ATGTGGTAGTTGCATGCCTGTGG - Intergenic
1177879085 21:26670467-26670489 ATTTTGCTGTTGAATGAAAGTGG - Intergenic
1178111903 21:29377117-29377139 ATGGGGTAGGGGAATGAGAGGGG + Intronic
1178422719 21:32455212-32455234 ATGTGGCAGAAGAATGGAAGGGG + Intronic
1178671178 21:34592922-34592944 ATGTGGGAACTGAAGGAAAGAGG + Intronic
1182130993 22:27850622-27850644 ATTTGGTAAATGAATGAAACAGG + Intergenic
1183852747 22:40604890-40604912 TTGTTGTCGTTGAATGAATGAGG + Intronic
1184410671 22:44324377-44324399 CTGTGGTTGTTGAATGAATGAGG - Intergenic
1184606007 22:45575296-45575318 GTGAGGTATTTGAGTGAAAGGGG + Intronic
949858657 3:8485455-8485477 ATTTGGTAATTGAAAAAAAGAGG - Intergenic
950601976 3:14042957-14042979 CTTGGGTAGTTGAAGGAAAGAGG - Intronic
951181525 3:19664725-19664747 ATGAGGAAGGAGAATGAAAGTGG - Intergenic
951222488 3:20083596-20083618 ATGGGGTTGTTTAAGGAAAGTGG + Intronic
951460635 3:22947749-22947771 ATGTGGTGGTAGAGTGAGAGTGG + Intergenic
955070463 3:55568517-55568539 ATGTGGAACATGAAGGAAAGAGG - Intronic
955092551 3:55767000-55767022 ATTTGTTAGTTGAATGAATTAGG - Intronic
955588402 3:60507296-60507318 ATTTGGTGGAGGAATGAAAGAGG + Intronic
955809637 3:62773731-62773753 ATGTGGTAGAGGTATGCAAGAGG - Intronic
958699825 3:97574294-97574316 ATGTGGTAGTTGAATGAAAGAGG + Intronic
958825415 3:99024136-99024158 ATGTGGTAGCTGAGTGAATTAGG + Intergenic
959259877 3:104063857-104063879 ATGTGGTAAATGTATGAAAATGG + Intergenic
960111005 3:113844588-113844610 ATGTGGTAGTTAAAAAACAGGGG + Exonic
960213328 3:114998645-114998667 ATATGGTAGTTAACTGAATGTGG + Intronic
961184572 3:124903351-124903373 ATTAGGTAGTTGAAGGAAACGGG + Intergenic
963607951 3:147428755-147428777 ATGTTGAAGTTGGATGATAGAGG - Intronic
964169480 3:153752523-153752545 ATGTGGATGTTGAGAGAAAGGGG + Intergenic
964577307 3:158187037-158187059 ATGTCGTAGTTGAAAGGATGTGG + Intronic
964888414 3:161511147-161511169 AAGTCACAGTTGAATGAAAGAGG + Intergenic
965021389 3:163236806-163236828 AACTGGTAGTTGAGTGACAGTGG + Intergenic
965285757 3:166817718-166817740 ATGTAGTAGTGGAAGGAGAGAGG - Intergenic
965413452 3:168362338-168362360 ATTTGGTAGTAGAATAAAAGTGG + Intergenic
965770561 3:172177445-172177467 ATGTGGTAGCTCAATCAGAGTGG + Intronic
965911973 3:173789392-173789414 ATGTGGAAGTTTAATGTAATAGG - Intronic
966037826 3:175441797-175441819 ATGTGCTGGTTAAATAAAAGAGG - Intronic
967792929 3:193568269-193568291 CTTTGGTAGTTAAAAGAAAGTGG - Intronic
968823073 4:2870819-2870841 GTGGGGTAGTTGAATAAAATTGG + Intronic
970619475 4:17802620-17802642 TTGAGGTAGTTGAATTAAACTGG - Exonic
970913224 4:21303732-21303754 ATGTCTTAGGTGAATGTAAGAGG - Intronic
971581997 4:28353472-28353494 ATGTGGTAGTGGAGTAACAGAGG - Intergenic
971593734 4:28500424-28500446 TTGTGGTAGTTGAGAGAAATTGG + Intergenic
971643425 4:29164970-29164992 AGGTGGTAGTTGGGAGAAAGAGG + Intergenic
972811005 4:42585763-42585785 ATGTACTGGTTGAATGAATGAGG + Intronic
974117915 4:57603368-57603390 CTGTTGTAGTTGAATGAATGTGG + Intergenic
975319484 4:72994227-72994249 ATGTGGTACTTACATGAATGTGG + Intergenic
975477386 4:74839299-74839321 ATTTAGTAGTTGAATGATATGGG - Intergenic
975884144 4:78944226-78944248 ATATGGTTGTAGAATTAAAGAGG - Intergenic
975996871 4:80325626-80325648 ATGTGGCAGTGGAATTAAAATGG - Intronic
976893313 4:90076938-90076960 AAGTTGTAGGTGAATGAAATAGG - Intergenic
977800979 4:101231069-101231091 AGGAGGTAGTTGTAGGAAAGAGG - Intronic
978193193 4:105939760-105939782 ATATGGGAGTTAAAGGAAAGAGG + Intronic
979397491 4:120206132-120206154 ATGTAGTATGTGAAAGAAAGAGG + Intergenic
979613623 4:122717148-122717170 ATTTGTTAAATGAATGAAAGAGG - Intergenic
980048361 4:128013823-128013845 ATGTGGTCATAGCATGAAAGAGG + Intronic
980562784 4:134499976-134499998 ATGTGGAAGTTGAGTGTCAGAGG - Intergenic
982501545 4:156162938-156162960 ATGATGAAGTTGAATGTAAGGGG + Intergenic
982554103 4:156839029-156839051 ATGTGGGGGTTGAAAGGAAGCGG + Intronic
983514801 4:168644616-168644638 ATGTGGTAGTTGTAGGAGAGAGG + Intronic
983853525 4:172613049-172613071 ATGTGGAAGCTGAATGAATGTGG - Intronic
984400145 4:179253112-179253134 ATCTGGTACTTTAATGAAAGAGG + Intergenic
984495360 4:180490231-180490253 ATGTGCTTTTTGAATTAAAGAGG + Intergenic
985615749 5:919998-920020 AGCTGGTACTTGAATGAAAGTGG - Intergenic
986771143 5:10974990-10975012 TAGTGGTAGCTGAATGAATGAGG + Intronic
987785724 5:22496070-22496092 ATGTTGTAGGTGAAAGAAATGGG + Intronic
988248759 5:28726234-28726256 ATGTGCAAGCTGAATGAATGAGG + Intergenic
988618920 5:32802591-32802613 AGATGGCAGTTGCATGAAAGAGG - Intergenic
991588879 5:68227863-68227885 AAGTGGTTTTTGAATGAAGGTGG - Intronic
993232141 5:85249399-85249421 ATGTTGTAGTTGAGTGACTGTGG + Intergenic
994474143 5:100245909-100245931 ATGTGATACTTGACTTAAAGGGG + Intergenic
996475218 5:123910791-123910813 ATTTGGTAGGTGAATAAAATAGG + Intergenic
996933958 5:128926618-128926640 AAGTGTTAGTGGAAGGAAAGAGG - Intronic
997849598 5:137319379-137319401 ATGTGTTAGATGAAAGAAAGGGG - Intronic
999260280 5:150234119-150234141 ATGTGGGAGTGGCAAGAAAGAGG - Intronic
999382791 5:151133200-151133222 AGGTGGCACTTGACTGAAAGAGG + Intronic
999875420 5:155800263-155800285 ATATGGAAGATGAATAAAAGAGG - Intergenic
999961409 5:156760014-156760036 TTTTTGTAGTTGAATGAATGAGG + Intronic
1001380644 5:171304371-171304393 CTGTGGCAGGTGAATGAATGAGG - Intergenic
1003153313 6:3571048-3571070 CTGTAGTAGATGAATGACAGAGG + Intergenic
1004285914 6:14320622-14320644 ATGTGTTAGTTGACTGAATCTGG - Intergenic
1004890877 6:20099281-20099303 AAGTGTTTGTTGAATGAATGAGG - Intergenic
1005493763 6:26370641-26370663 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005498317 6:26407990-26408012 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1007305808 6:40903387-40903409 ATGTTGTTTATGAATGAAAGAGG - Intergenic
1008101887 6:47400654-47400676 ATGTCTGAGTTGAATGACAGAGG - Intergenic
1008592189 6:53005506-53005528 ATGTGGTATATGAAAAAAAGAGG - Intronic
1009009651 6:57826794-57826816 ATTTGGTGTTTGAATGAATGGGG - Intergenic
1009414657 6:63402100-63402122 ATGTGGAAGTTTGATGACAGTGG + Intergenic
1010516936 6:76784698-76784720 ATGTGGTATATGAGAGAAAGAGG - Intergenic
1010558874 6:77323088-77323110 AAGTGGTAGTTTATTGAAATTGG + Intergenic
1011097656 6:83683889-83683911 GTGTGGTGGTTGACTGAACGTGG - Intronic
1011325525 6:86147126-86147148 ATGTGGGGGTTGAAAGAAAGCGG - Intergenic
1013594502 6:111648516-111648538 GTGTGGAAGTTGAAAGAAAGAGG + Intergenic
1014730103 6:125022498-125022520 ATGTGCTAATTGAAAGAAAAAGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1014970016 6:127802355-127802377 ATTTTGTAGTTGAGTGACAGTGG - Intronic
1015023628 6:128507049-128507071 ATGTGGAAACTGAAGGAAAGTGG + Intronic
1015257643 6:131197944-131197966 ATGTGGAGGTTGAAAGGAAGTGG + Intronic
1016449007 6:144161833-144161855 ATTTGGAATTTGAATGTAAGGGG + Intronic
1017228069 6:152042945-152042967 ATTTTGTAGTTGAATGACTGTGG + Intronic
1018051914 6:160016530-160016552 AAGTGGTACTTGCAGGAAAGAGG - Intronic
1018588731 6:165392105-165392127 CTGTGGTTGATGAATGGAAGTGG + Intronic
1020345204 7:7154747-7154769 AGGAGGTAGTTGAATCACAGAGG + Intergenic
1020730007 7:11868730-11868752 ATGTGGAAGTTACTTGAAAGTGG + Intergenic
1021286730 7:18789606-18789628 ATTTGGAAGTTGAAGGACAGTGG - Intronic
1022349739 7:29556774-29556796 GGGTGGTAGTTGGATGCAAGAGG + Intergenic
1023115757 7:36860410-36860432 ATGAGGTAATAGAAGGAAAGTGG + Intronic
1023662279 7:42482070-42482092 ATGTGTAAGTTGAAGGAAACAGG - Intergenic
1024431114 7:49288895-49288917 ATGTGGTGGTTTCATGGAAGGGG + Intergenic
1024801450 7:53085135-53085157 ATGGTTTAGTTGAATGAAAATGG + Intergenic
1028082509 7:86596189-86596211 ATGTGTTAGCTAAATGAAAATGG + Intergenic
1028302419 7:89217167-89217189 ATCTGGTAATAGAATTAAAGAGG + Intronic
1028738584 7:94246756-94246778 AGGTGGCAGGTGAATGAATGAGG + Intergenic
1030541529 7:110836384-110836406 AGGAGGTAATTGAATGATAGAGG + Intronic
1030935032 7:115575103-115575125 ATGTGGTAGGTGGAGGAGAGGGG + Intergenic
1032630365 7:133644385-133644407 ATTTTGTAGTTGAATGACTGTGG + Intronic
1033579263 7:142716703-142716725 TTGTGGTAGTTGAAGGATAAGGG - Intergenic
1033990969 7:147286774-147286796 ATATGGTAGGTGAATGGAAAGGG - Intronic
1037024490 8:14017000-14017022 ATGTGTTTGTTGAATAAAAGCGG + Intergenic
1038837279 8:31140354-31140376 ATGTGTAGGATGAATGAAAGAGG + Intronic
1039348282 8:36732342-36732364 ATATGGAAGATGAATGGAAGAGG - Intergenic
1039383497 8:37108263-37108285 ATGAAGTATTTGAATGAAATTGG + Intergenic
1040685299 8:49864573-49864595 ATGTGCTAGTTTGATGAAAAAGG + Intergenic
1040916390 8:52569695-52569717 ATTTTGTAGTTGAATGACTGTGG + Intergenic
1043260210 8:78186009-78186031 ATGTTGTAGTTGAATGACTGTGG + Intergenic
1043919416 8:85964158-85964180 AGGTGTTTGTTAAATGAAAGAGG - Intergenic
1046903011 8:119542779-119542801 AGGTGGTAATTGAATCATAGGGG + Intergenic
1047163743 8:122412362-122412384 ATGTGGAGGCTGAAGGAAAGAGG - Intergenic
1047329373 8:123872455-123872477 AGGTGGTAGTTAAATGTAATGGG + Intronic
1048885075 8:138903255-138903277 ATGTGGCTATTAAATGAAAGAGG + Intronic
1049131088 8:140842804-140842826 ATATGATAGTTAAAAGAAAGAGG - Intronic
1050079046 9:1895493-1895515 ATGTGGCAGATGAAAGAAAAGGG + Intergenic
1051217404 9:14813385-14813407 ATGTGTGAGTTTAATGAAAGAGG - Intronic
1051394876 9:16609063-16609085 ATGGGCTGTTTGAATGAAAGGGG + Intronic
1052245400 9:26328233-26328255 ATTTGGTAGTTAAATGAGAATGG - Intergenic
1052567567 9:30176032-30176054 ATGTGGGAGTTGAAAAAATGGGG + Intergenic
1052858299 9:33420910-33420932 TTGTAGATGTTGAATGAAAGAGG - Intergenic
1055359184 9:75470980-75471002 ATGTGGTAATCCAATGACAGGGG + Intergenic
1055665897 9:78552729-78552751 ATGTGACCTTTGAATGAAAGAGG - Intergenic
1055931305 9:81562372-81562394 GAATGGCAGTTGAATGAAAGGGG + Intergenic
1056070298 9:82979258-82979280 ATGTGGGGGTAGAAAGAAAGGGG + Intergenic
1056088639 9:83182459-83182481 TTTTGGTTGTTGAATGACAGTGG - Intergenic
1058481628 9:105401767-105401789 AAATGCTTGTTGAATGAAAGTGG - Intronic
1058661996 9:107275033-107275055 ATGTGGTATGTGAGAGAAAGAGG - Intergenic
1058872460 9:109214404-109214426 ATCTGGGAGCTGAAAGAAAGAGG + Intronic
1060019235 9:120114856-120114878 ATGTCATAATTGAAAGAAAGGGG - Intergenic
1061933139 9:133843642-133843664 ATGTGGTATGTGAAGGAAGGAGG + Intronic
1186316220 X:8373568-8373590 ATGTGGGGGTTGAAAGGAAGTGG - Intergenic
1186345321 X:8685970-8685992 ATGTGGTAGTGGAACAAAGGTGG - Intronic
1188515630 X:30982397-30982419 ATGTGGAAGTTGAATGGGATGGG - Intergenic
1188679729 X:32987585-32987607 ATGTGGCAGTTTAATGACAGAGG - Intronic
1191190540 X:57662068-57662090 ATCTGGAAGATGAAGGAAAGGGG - Intergenic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1194596274 X:95862544-95862566 ATGTGGTAGTTGATACAATGTGG + Intergenic
1194786176 X:98086739-98086761 ATCTGGGATTTGAACGAAAGTGG + Intergenic
1196236680 X:113289616-113289638 ATTTGGTAGTGGAATGAGTGTGG + Intergenic
1199539759 X:148945920-148945942 ATGTGGCAGTGGATTGAAAATGG + Intronic
1199858664 X:151780486-151780508 AGGTGGCAGGAGAATGAAAGGGG + Intergenic