ID: 958702023

View in Genome Browser
Species Human (GRCh38)
Location 3:97604084-97604106
Sequence TTATAGCCTCCTCCTTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958702023_958702027 23 Left 958702023 3:97604084-97604106 CCACCCTAAGGAGGAGGCTATAA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 958702027 3:97604130-97604152 TCAATAATAAGATACAAATGAGG 0: 1
1: 0
2: 2
3: 33
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958702023 Original CRISPR TTATAGCCTCCTCCTTAGGG TGG (reversed) Intronic
900106343 1:982738-982760 TCCAAGCCTCCTCCTTAGAGAGG - Intergenic
902826169 1:18975917-18975939 TTATATTCACCTCCTCAGGGTGG + Intergenic
903690310 1:25168608-25168630 TTACTGCCTCCTACTCAGGGAGG + Intergenic
904901550 1:33861758-33861780 TTATCTCCTCCTGCCTAGGGTGG - Intronic
906923101 1:50085838-50085860 TGCAAGCCTCCTTCTTAGGGAGG + Intronic
907892629 1:58650092-58650114 TTACCGTCTCCTCCTTAGGAGGG - Intergenic
914910150 1:151778786-151778808 ATGTCGCCTCCTCCTTTGGGTGG + Exonic
915717324 1:157956868-157956890 TTATAGCCTCCCCTATAAGGTGG - Intergenic
917091039 1:171353542-171353564 TAAAAGTCTCCTCCTTAGAGGGG + Intergenic
917113024 1:171571343-171571365 GTATAGTCTCCCTCTTAGGGAGG - Exonic
1067437590 10:46288934-46288956 TCATTGCCTCCTCCTTAGAATGG - Intronic
1069771407 10:70902861-70902883 TTCCAGTTTCCTCCTTAGGGAGG + Intergenic
1070090125 10:73276530-73276552 TTAAAGCCTCCTGCTTAATGTGG + Intronic
1070348438 10:75568183-75568205 TTATAGCCTCCTTCGTGGAGGGG + Intronic
1073468092 10:103706053-103706075 TTCTAGACTCTTCCTTAGGGAGG + Intronic
1073930288 10:108567016-108567038 TTTTAGCCTCCTCATTCGGCGGG - Intergenic
1078953070 11:16157286-16157308 TTTTAGCCTCCTCTTTTGAGGGG + Intronic
1079294344 11:19218930-19218952 CCACAGCCTCCTCCTGAGGGCGG - Intergenic
1082069673 11:47928849-47928871 TTATAACCTCCTCATGAGGTGGG - Intergenic
1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG + Exonic
1084465661 11:69321515-69321537 TCAAAGCCTCCTGCATAGGGAGG - Intronic
1085651962 11:78276449-78276471 TAATACTCTCCTCCTTAGGGAGG + Intronic
1085782983 11:79426070-79426092 TCATAGCCTACTCCTGAAGGTGG - Intronic
1094333176 12:29318912-29318934 TGACAGTCTCTTCCTTAGGGAGG - Intronic
1104434097 12:128742187-128742209 TCATAGCCTCCTTCACAGGGAGG - Intergenic
1107201411 13:37723145-37723167 TTATAATCTTGTCCTTAGGGAGG + Intronic
1107242076 13:38248291-38248313 TGATAGCTCCCTCCTTAAGGAGG - Intergenic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1107963585 13:45579757-45579779 TTTTAGCCTCCTTCTTGAGGAGG + Intronic
1108774923 13:53754034-53754056 CTATATACTCCTCCTAAGGGAGG + Intergenic
1109656295 13:65395279-65395301 TTCTAGCCTTCTCCTTAGTTGGG + Intergenic
1110607212 13:77446859-77446881 TTCTAGCCTCATCCTAAGAGGGG - Intergenic
1115022524 14:28699998-28700020 TAAAAGCCTCCTCCTTACTGAGG + Intergenic
1118383905 14:65239536-65239558 TCATATCCTCCTCCTCAGGAGGG + Intergenic
1120386996 14:83858854-83858876 ACAAAGCCTCCTCCTTAGGGTGG + Intergenic
1122204267 14:100140813-100140835 TGACAGCCTCCTCCTCAGGGTGG - Intronic
1130203482 15:81854423-81854445 ATATAGCACCCTCCTCAGGGAGG - Intergenic
1132513221 16:354017-354039 TCACATCCTCCTCCTTGGGGAGG - Intergenic
1136283622 16:29228860-29228882 TTAAAGCCTCCTCCGGTGGGGGG + Intergenic
1140240581 16:73196270-73196292 CTAGAGCTTCCTCCTTGGGGTGG + Intergenic
1142088655 16:88198371-88198393 TTAAAGCCTCCTCCGGTGGGGGG + Intergenic
1143041781 17:4043504-4043526 TCCCAGCCTCCTCCTTATGGTGG - Intronic
1149535782 17:57432336-57432358 ATACAGCCTCCTCCATAAGGAGG - Intronic
1156594075 18:38525801-38525823 CTAACGCCTACTCCTTAGGGAGG - Intergenic
1168615357 19:57833112-57833134 TTATGTCCTTCTCCTTAGGACGG + Intronic
1168621427 19:57882335-57882357 TTATGTCCTTCTCCTTAGGACGG - Intronic
927612356 2:24554233-24554255 TTTAAGCCTCCACCTTAAGGAGG - Intronic
927635980 2:24817215-24817237 TTAGAGACTGCTCCGTAGGGAGG - Intronic
927749014 2:25649747-25649769 TTATAGATTCCTACTTAGGTAGG - Intronic
930771340 2:55133491-55133513 TTGTAACCTCCTCCTTATGCAGG + Intergenic
938982106 2:136536729-136536751 TAACAGCCTCCTCCTTGGTGAGG - Intergenic
940173481 2:150853161-150853183 TGTTAGCATCCTCCTTTGGGTGG - Intergenic
1170271198 20:14528875-14528897 ATATACCTTCCTCCATAGGGTGG - Intronic
1173255174 20:41389474-41389496 TTATTGCCTCTACCTCAGGGAGG + Intergenic
1174128801 20:48327445-48327467 TTATCTCCTCATCCTCAGGGCGG + Intergenic
1181681899 22:24501250-24501272 CTATAGTCTCCTCCTTTGAGAGG - Intronic
1181692771 22:24574334-24574356 TTATATCCTGCATCTTAGGGGGG + Intronic
1183466792 22:37984090-37984112 TTTTAGCCTCCTTTTTTGGGTGG + Intronic
950727396 3:14925639-14925661 TTATAGTCTCCTGCCTAGTGGGG - Intronic
951298809 3:20970966-20970988 TTGTAGCAACCTCCTTGGGGAGG + Intergenic
958702023 3:97604084-97604106 TTATAGCCTCCTCCTTAGGGTGG - Intronic
959984703 3:112559938-112559960 TTACAGTTTCCTGCTTAGGGAGG - Intronic
967222591 3:187260191-187260213 CTATAGTCTCGTGCTTAGGGAGG - Intronic
974132581 4:57774875-57774897 TAGCAGCCACCTCCTTAGGGTGG + Intergenic
977289521 4:95148877-95148899 TTTTGGCCTCATCCTTTGGGAGG + Exonic
980064014 4:128162746-128162768 TTATAGCCTTTTCCTGAAGGTGG + Intronic
982031814 4:151308634-151308656 TTAGAGCCTCTTTCTTGGGGAGG + Intronic
984871806 4:184332217-184332239 TAAGAGGCTCCTCCTTTGGGAGG - Intergenic
986186593 5:5447034-5447056 ATATAGCCTCTTTATTAGGGAGG - Intronic
988117635 5:26918282-26918304 TTACAATTTCCTCCTTAGGGAGG + Intronic
995066198 5:107865755-107865777 TCATGGGCTCCTACTTAGGGAGG + Intronic
996646634 5:125825846-125825868 TTTTAGACTCCTCCTTTGAGAGG + Intergenic
996818147 5:127596306-127596328 TGATAGCCTCCTCCACAGGCAGG - Intergenic
997083364 5:130766736-130766758 TTAAAGCCTTCTTCTAAGGGTGG + Intergenic
1001203140 5:169737603-169737625 TTTCAGCCTCCCCCATAGGGAGG + Intronic
1001751718 5:174136507-174136529 TTCTAGCCTCCATGTTAGGGTGG + Intronic
1005682528 6:28220967-28220989 TTATACCCTCCTCTTTTGTGTGG - Intergenic
1007601759 6:43086426-43086448 TTTTTGTCTCCTCCTTGGGGTGG + Intronic
1011940940 6:92842359-92842381 TCAGTGCCTCCTCCTTAGAGGGG + Intergenic
1011998977 6:93629982-93630004 TTTGAGCTTCCTCCCTAGGGAGG - Intergenic
1013246193 6:108289696-108289718 TTGTAGCCACCTCCCTAGGGAGG - Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1018488409 6:164266832-164266854 TTATAGCCCCCAACTTACGGGGG + Intergenic
1020162647 7:5783950-5783972 TTACAGCCTTCTTCTTAGGATGG + Intergenic
1020423463 7:8036375-8036397 TTATAGTCTCATCCTTAAGATGG + Intronic
1023956637 7:44891876-44891898 TTGCAGCCTCCTCCTTAGTGTGG - Intergenic
1024132005 7:46362671-46362693 CTATACCCTGCTGCTTAGGGAGG + Intergenic
1024685844 7:51744429-51744451 TTGTTGCATCCTCCTTAGAGTGG - Intergenic
1024896045 7:54263497-54263519 TTATTGCAGCCTCTTTAGGGTGG + Intergenic
1028854888 7:95579433-95579455 TTACAGCCTCTTCCTTATAGGGG - Intergenic
1030161312 7:106511132-106511154 TTGTAGCCTCCTGTTTACGGAGG - Intergenic
1032524850 7:132572425-132572447 TCACAGCCTCTTCCTTTGGGAGG + Intronic
1033520479 7:142155395-142155417 TCATAAACACCTCCTTAGGGGGG - Intronic
1037478793 8:19285400-19285422 TTAAAGCCACATCCTTAAGGGGG - Intergenic
1047230335 8:122992660-122992682 TTATAACCTCTTACTTAGGATGG - Intergenic
1049011329 8:139889655-139889677 TTATAGCCTCCTTCCTGGGTCGG - Intronic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1057286170 9:93756319-93756341 TTAAAGTCACATCCTTAGGGGGG - Intergenic
1061027987 9:128062965-128062987 TAATATCTTCCTCCTTTGGGAGG - Exonic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1203770951 EBV:49897-49919 TTATAGCCTCACCCTTAGTCAGG - Intergenic
1188371811 X:29378887-29378909 TTATAGCCTCTGCCCAAGGGAGG - Intronic
1189186253 X:39057991-39058013 TCATAGTCACCTTCTTAGGGAGG - Intergenic
1200182095 X:154156752-154156774 TTATAGTCTCGGCCTGAGGGTGG + Intronic
1200187749 X:154193866-154193888 TTATAGTCTCGGCCTGAGGGTGG + Intergenic
1200193399 X:154231006-154231028 TTATAGTCTCGGCCTGAGGGTGG + Intronic
1200199154 X:154268810-154268832 TTATAGTCTCGGCCTGAGGGTGG + Intronic