ID: 958707913

View in Genome Browser
Species Human (GRCh38)
Location 3:97679299-97679321
Sequence CTGTGTGTGGGGACGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958707913_958707921 12 Left 958707913 3:97679299-97679321 CCAGAGGGCGTCCCCACACACAG 0: 1
1: 0
2: 3
3: 16
4: 154
Right 958707921 3:97679334-97679356 CCTCAGCTGGAAGATAATCATGG 0: 1
1: 0
2: 0
3: 6
4: 177
958707913_958707918 -1 Left 958707913 3:97679299-97679321 CCAGAGGGCGTCCCCACACACAG 0: 1
1: 0
2: 3
3: 16
4: 154
Right 958707918 3:97679321-97679343 GTCAGGTAGTTTCCCTCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958707913 Original CRISPR CTGTGTGTGGGGACGCCCTC TGG (reversed) Intronic
900220816 1:1508527-1508549 CAGGGTGTGGGGACCCCCACTGG - Intergenic
900225818 1:1533239-1533261 CAGGGTGTGGGGACCCCCACTGG - Intronic
900327599 1:2116602-2116624 CTGTGTGTGGGGCCTCTTTCTGG + Intronic
900756181 1:4436512-4436534 CTGTCTTTGGGGAGGCCCTTGGG + Intergenic
901646144 1:10717815-10717837 CTGTTTATGAGGACGTCCTCCGG - Intronic
901916529 1:12504694-12504716 CTCTGAGCTGGGACGCCCTCCGG - Intronic
902667885 1:17952331-17952353 CTGTGGGTGGGGACACCGTGTGG + Intergenic
915808335 1:158878412-158878434 CTGTGTGTGGTGTCGAACTCTGG - Intergenic
917325188 1:173824700-173824722 CTGTGTTTGGGTTCGCGCTCTGG + Exonic
917963000 1:180159100-180159122 ATGGGTGAGGGGATGCCCTCTGG - Intronic
921597157 1:217066699-217066721 CTGTGTGGGGGGATGCCCTGTGG + Intronic
1072903643 10:99431006-99431028 CTGTGTTCGGGAACTCCCTCCGG - Intergenic
1077080273 11:721899-721921 CGCAGTGTGAGGACGCCCTCTGG - Exonic
1077269536 11:1669024-1669046 CGGTGTGTGGGGGCGTCTTCAGG - Intergenic
1077540567 11:3144755-3144777 CTGAGCGTGGGGACGCCTTGGGG - Intronic
1079051400 11:17163558-17163580 CTGTGTGTGGTGATGCACGCTGG - Intronic
1084941379 11:72615151-72615173 CTGTGGATGGGGACACCCTTGGG - Intronic
1087154998 11:94893919-94893941 CTGTGTTTGTGGAAGCCATCAGG + Intergenic
1087630012 11:100638872-100638894 CTGTGTATGGGGACTCCATGAGG - Intergenic
1087675650 11:101158387-101158409 CTCTGTGTGGGGAGCCCCACTGG - Intergenic
1089388742 11:118085735-118085757 CTGTGTGGCGGGACCCCTTCTGG + Intronic
1089983247 11:122789769-122789791 CTGTGTCTGGGGACTTGCTCAGG - Intronic
1091894620 12:4091198-4091220 CTGTCTCTGGGAACCCCCTCTGG - Intergenic
1092167896 12:6354341-6354363 CTGTTTGTGGGGATGACTTCTGG - Intronic
1099347478 12:81520741-81520763 AAGTGTGTGGGGATGCTCTCAGG - Intronic
1104385925 12:128351582-128351604 CTGGATCTGGGGAGGCCCTCAGG + Intronic
1104946026 12:132415244-132415266 GTGTGTGTGGGGGCATCCTCGGG - Intergenic
1107411271 13:40160758-40160780 GTGGGTGTGGGAAGGCCCTCTGG + Intergenic
1116856050 14:49953260-49953282 CAGCATGTGGGGAGGCCCTCTGG + Intergenic
1121121150 14:91376684-91376706 CTGTCTGTGGGGAGGCCCAGGGG + Intronic
1121244191 14:92450634-92450656 CTGTGTGTGGGGACCGTCTCGGG - Intronic
1123007423 14:105330548-105330570 CTGGGTGTGTGGCCGCTCTCTGG + Intronic
1123473602 15:20571799-20571821 CTGTGAGTGGGGAGACCCACCGG + Intergenic
1123644407 15:22428554-22428576 CTGTGAGTGGGGAGACCCACCGG - Intergenic
1123665721 15:22608456-22608478 CTGTGAGTGGGGAGACCCACTGG - Intergenic
1123733900 15:23166810-23166832 CTGTGAGTGGGGAGACCCACCGG + Intergenic
1123752039 15:23364196-23364218 CTGTGAGTGGGGAGACCCACTGG + Intronic
1124284405 15:28388121-28388143 CTGTGAGTGGGGAGACCCACCGG + Intronic
1124298292 15:28523493-28523515 CTGTGAGTGGGGAGACCCACCGG - Intronic
1124319543 15:28702870-28702892 CTGTGAGTGGGGAGACCCACTGG - Intronic
1124482969 15:30092561-30092583 CTGTGAGTGGGGAGACCCACTGG + Intronic
1124520608 15:30404657-30404679 CTGTGAGTGGGGAGACCCACCGG - Intronic
1124538049 15:30561562-30561584 CTGTGAGTGGGGAGACCCACTGG + Intronic
1124544509 15:30613623-30613645 CTGTGAGTGGGGAGACCCACTGG + Intronic
1124564472 15:30801058-30801080 CTGTGAGTGGGGAGACCCACTGG + Intergenic
1124754107 15:32393695-32393717 CTGTGAGTGGGGAGACCCACTGG - Intronic
1124760601 15:32446023-32446045 CTGTGAGTGGGGAGACCCACTGG - Intronic
1124778032 15:32603039-32603061 CTGTGAGTGGGGAGACCCACTGG + Intronic
1124959210 15:34382365-34382387 CTGTGAGTGGGGAGACCCTCCGG - Exonic
1124975836 15:34528586-34528608 CTGTGAGTGGGGAGACCCTCCGG - Exonic
1130276180 15:82477424-82477446 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130468539 15:84204817-84204839 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130495725 15:84468725-84468747 CTGTGTTTGGGGAGACCCACCGG + Intergenic
1130590832 15:85209416-85209438 CTGTGTTTGGGGAGACCCACCGG - Intergenic
1130991242 15:88877340-88877362 CTGTGTGGGGAGGGGCCCTCAGG - Exonic
1131188532 15:90294797-90294819 CTGTGTGTGGGGGGACCCACCGG + Intronic
1132184545 15:99792063-99792085 CTGTGAGTGGGGAGACCCACCGG + Intergenic
1132897227 16:2234836-2234858 CTGTGGGTGGGGACTCGGTCAGG - Intronic
1133285092 16:4686980-4687002 CTGTGTGAGCGGACGCCCTCAGG - Intronic
1135975722 16:27108095-27108117 CTGTGTGTGGGGGTGCCCCAGGG - Intergenic
1140976316 16:80063182-80063204 CTGGGCGTGGAGACGGCCTCTGG + Intergenic
1141721143 16:85756019-85756041 CGGTGTTTGGGGACACACTCAGG - Intergenic
1141904246 16:87013177-87013199 CAGCGTGTGGGCTCGCCCTCTGG - Intergenic
1142903975 17:3030846-3030868 CTGTGTGTGGGGACTGGCTAGGG - Intronic
1145058447 17:19717738-19717760 CTGTGTTTGGGGCCGCCCATGGG - Intronic
1148462317 17:47845860-47845882 TTGAGTGTGGGAAAGCCCTCCGG + Exonic
1150132484 17:62676606-62676628 CTGTTTATGGGGAAGCCCTGGGG - Intronic
1150434155 17:65141107-65141129 CTGTGGGTCGGGATGCCCGCCGG + Intronic
1151932434 17:77241142-77241164 GTGTGTGTGGCGGCGCCCGCAGG + Intergenic
1152123869 17:78434893-78434915 CTGTGTGGGGGGAGGGCTTCAGG + Intronic
1153535574 18:6098283-6098305 CTGTGTGCGGCTACACCCTCAGG + Intronic
1157559490 18:48636660-48636682 CTGTGGGGGGGCTCGCCCTCGGG - Exonic
1157564399 18:48670162-48670184 CTGTGAGTGGGCGTGCCCTCGGG - Intronic
1157720061 18:49916693-49916715 GTGAGGGTGGGGACACCCTCAGG + Intronic
1158253683 18:55520009-55520031 CTGGGTGTGGGGAGGTCTTCAGG - Intronic
1160537135 18:79600716-79600738 CTGTGTGGAGGGACCCCCTGTGG - Intergenic
1160537156 18:79600776-79600798 CTGTGTGGAGGGACCCCCTGTGG - Intergenic
1160537178 18:79600836-79600858 CTGTGTGGAGGGACCCCCTGCGG - Intergenic
1160722011 19:601928-601950 CTGGGAGTGGAAACGCCCTCTGG + Intronic
1161232333 19:3180492-3180514 GTGTGTGTGTGGACAACCTCTGG + Intergenic
1161950024 19:7462732-7462754 CTGTGCGTGGGGACCCACTGAGG - Intronic
1162808480 19:13151008-13151030 CTGTGTGTGGGGTCTCCGTCTGG + Intronic
1163035005 19:14565002-14565024 CTGGGTGTGGGGACGGGGTCGGG + Intronic
1163455327 19:17403145-17403167 CTGGGTGTGGGGACACAGTCGGG - Exonic
1164156877 19:22602463-22602485 CTGTGTGTGGGGGGACCCACCGG + Intergenic
1164551503 19:29216387-29216409 CTGGTTGGGGGGGCGCCCTCAGG + Intergenic
1164752681 19:30668431-30668453 TTTTGTGTGGGGGCGCCTTCTGG + Intronic
1165225750 19:34353301-34353323 CTGTGTGTTGGGAAGACATCAGG + Exonic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
1166500011 19:43333277-43333299 CTGTGTGTGATGTCGCCCCCTGG + Intergenic
1166960066 19:46491929-46491951 CTGTGGGTGGGGAGGGCCCCAGG - Exonic
1167015506 19:46838549-46838571 CTGTGTGAGGGGAGACCCTGGGG + Intronic
1167432979 19:49464005-49464027 CTGTGCCTGGGGAAGCCCTTGGG + Intronic
1168241197 19:55089714-55089736 CTGTGTGTGTGGAGGCCCTGGGG - Intergenic
1168267802 19:55231841-55231863 CTCTGAGTGGGGAGGCCCTGGGG + Exonic
927715651 2:25350485-25350507 CTGTTTCTGGTGAGGCCCTCAGG - Intergenic
932720831 2:74138094-74138116 GTGTGTTTTGGGAAGCCCTCAGG - Intronic
935182458 2:100703027-100703049 CTGTTTCTGGGGAGGGCCTCAGG - Intergenic
935268497 2:101414233-101414255 CTCTGTGTGGGGCCTCCCTCTGG + Intronic
935585942 2:104800498-104800520 CTGGGTGTGCTGGCGCCCTCAGG - Intergenic
936470417 2:112793509-112793531 CTGTGTCTGGTGAGGGCCTCAGG - Intergenic
936887208 2:117326082-117326104 CTGTTTCTAGGGATGCCCTCTGG - Intergenic
938373245 2:130787088-130787110 CTGTTTCTGGGGACGCCTTAGGG + Intergenic
939851479 2:147311280-147311302 CACTGTGTGGGGCCTCCCTCTGG - Intergenic
945040266 2:205738255-205738277 CTGTGTGTGTGGTCGCCATCAGG - Intronic
947607270 2:231495817-231495839 CTGTTGGTGGGGAGACCCTCAGG + Intergenic
947856346 2:233327040-233327062 CTGTGTGAGGTGTGGCCCTCTGG + Intronic
948783694 2:240340182-240340204 CTCTGTGTGGGGCAGCCCTGCGG + Intergenic
948785168 2:240348447-240348469 CTGTGTGTGGTGAGGCTCTGGGG - Intergenic
948851983 2:240713039-240713061 CCTTGTGTGGGGCCACCCTCTGG - Intergenic
1171312075 20:24152678-24152700 CTGTGTGGGGAGACGGCCTGTGG - Intergenic
1172772377 20:37389176-37389198 CTGGGTGTGAGGAAGCCCTCTGG + Intronic
1174400784 20:50274811-50274833 CAGGGTGCGGGGAAGCCCTCTGG - Intergenic
1175172860 20:57092272-57092294 CAGTGAGTGCGGACGCCCTCTGG - Intergenic
1175515702 20:59568511-59568533 CTGTGTATGGCGACTCCCTGAGG - Intergenic
1175734246 20:61374265-61374287 CTGTGCATGGGGACGGCCCCTGG - Intronic
1175922672 20:62457432-62457454 CTGTGTGTGGGGAGGGTCCCCGG - Intergenic
1179959174 21:44758733-44758755 CAGTGTGTGTGGACCGCCTCTGG - Intergenic
1181308509 22:21930809-21930831 CTGTGGGTGAGGAAGGCCTCAGG - Intronic
949280741 3:2343885-2343907 CTGTGTGTGGTGACAGCCTCAGG + Intronic
950378152 3:12589054-12589076 CTGTGTCTGGTGAGGCCCTCAGG - Intronic
954107821 3:48418781-48418803 ATGGGTGTGGAGACTCCCTCAGG + Intronic
954419483 3:50411067-50411089 CTGTGTGTGGGGTGGCTCACTGG + Intronic
958707913 3:97679299-97679321 CTGTGTGTGGGGACGCCCTCTGG - Intronic
959685168 3:109137580-109137602 CTGTGTGTGGGAAGGGCTTCAGG - Intergenic
962910547 3:139845353-139845375 ATGTGTGGGGTGAGGCCCTCTGG - Intergenic
963974091 3:151461097-151461119 CTGTGTCTGGGGACGCGGCCGGG + Intergenic
964344761 3:155744663-155744685 CTGTGCGTGGGGATCCCCTAAGG - Intronic
968657077 4:1783337-1783359 GGGTGTGTGGGGCCGCCCTGGGG + Intergenic
968916909 4:3500571-3500593 ATCTGAGTGGGGACACCCTCAGG - Intronic
969184184 4:5463313-5463335 CTGTGTGCTGGGATGCCCTGGGG + Intronic
969868121 4:10088401-10088423 ATGTGTGTGTGAACACCCTCTGG + Intronic
974980353 4:68948910-68948932 CTGTGTCTGGTGAAGACCTCTGG + Intronic
975698568 4:77039465-77039487 CTGGGTGTGGTGGCCCCCTCAGG - Intronic
989477852 5:41894921-41894943 CCGGGTGTGGGGGGGCCCTCAGG - Intergenic
990442270 5:55858886-55858908 CTGTATGTAGGGAAGCCGTCAGG + Intronic
997804886 5:136907003-136907025 CTGTATCTGGGGAGGGCCTCAGG - Intergenic
998210099 5:140189395-140189417 CTGTGTCTGGTGAAGCTCTCAGG - Intronic
999377387 5:151096164-151096186 CGCTGTGCGAGGACGCCCTCTGG - Intergenic
1000594752 5:163202055-163202077 CTGTGTCTGGTGAGGACCTCAGG - Intergenic
1001773220 5:174311295-174311317 CTGTGTGTGAGGAGGCCCGGGGG + Intergenic
1002048274 5:176554210-176554232 CTGTGTGTGGAGGAGCCCTGGGG - Intronic
1002447831 5:179300951-179300973 CAGTGTGTGGGGACATCCTCCGG - Intronic
1002783394 6:383760-383782 CTGGGTGTGGAGTCGTCCTCTGG - Intergenic
1004580440 6:16946173-16946195 CTGTGTCTGGGGCTGCCCTCAGG + Intergenic
1006758979 6:36442888-36442910 CCGTGTCTGGGGACCCCGTCCGG - Exonic
1007726258 6:43917637-43917659 CAGTGTGGGGGGCTGCCCTCAGG - Intergenic
1009975768 6:70668534-70668556 CTGTGGGTGGGGCCGCGCTTAGG + Intronic
1018412435 6:163565022-163565044 CTGTGTGTGTGCATGCACTCAGG + Intronic
1019385712 7:754943-754965 CTGGGTGTGGGGAGGGCCTGCGG - Intronic
1019999350 7:4746417-4746439 CTGGGTGTGGTGACGCACTTTGG + Intronic
1020279034 7:6640899-6640921 CTGTTTCTGGGGAGGGCCTCAGG - Intronic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021984824 7:26088347-26088369 ATGTTTGTGGGGAAGCCATCAGG - Intergenic
1035222602 7:157414983-157415005 CTGAGTGTGGGCAGGGCCTCAGG + Intronic
1035567394 8:650547-650569 CAGTGTCTGGGGCCGGCCTCGGG - Intronic
1036796080 8:11757687-11757709 GTGTGTCAGGGGACGCCCTGGGG + Intronic
1051570721 9:18555641-18555663 CTGTGTGAGGCAACTCCCTCTGG - Intronic
1055552036 9:77440320-77440342 CCGAGTGTGGTGAGGCCCTCTGG + Intronic
1056809678 9:89754577-89754599 CTGTGGGTGGGGATTCCCTGAGG - Intergenic
1057092019 9:92266810-92266832 CTGCATGTGGGGAGGACCTCAGG - Intronic
1057147042 9:92765195-92765217 CTGAGTGTGGGGAAGGCCGCGGG - Intergenic
1057953618 9:99389531-99389553 CTGGGTGTGGGGAAGCACACAGG - Intergenic
1059522401 9:114955939-114955961 CTGTCTGTGGGGTTGCCATCAGG + Intergenic
1061062565 9:128258010-128258032 CTGTGTGTGGGGAGACCCACCGG - Exonic
1203377102 Un_KI270442v1:384915-384937 CTCTGTGTGGAGACTCTCTCTGG + Intergenic
1186412791 X:9358592-9358614 CTGTGTGTGGTGGCTCACTCCGG + Intergenic
1191108280 X:56785937-56785959 CTGGTTGCGGGGACACCCTCAGG + Intergenic
1194371830 X:93083221-93083243 CTGTGTGTGGTGGCGCCCGCCGG - Intergenic
1200679873 Y:6197255-6197277 CTGTGTGTGGTGGCACCCGCCGG - Intergenic
1200974992 Y:9200669-9200691 CTGTGTGTGGTGATGGGCTCCGG - Intergenic
1201063547 Y:10069123-10069145 CTGTGGGCGGGTAGGCCCTCAGG + Intergenic
1202372901 Y:24210345-24210367 CTGTGTGTGGGGACACCCACTGG - Intergenic
1202497881 Y:25459775-25459797 CTGTGTGTGGGGACACCCACTGG + Intergenic