ID: 958709477

View in Genome Browser
Species Human (GRCh38)
Location 3:97699923-97699945
Sequence TTGCCTCAGCCCAAGTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958709474_958709477 21 Left 958709474 3:97699879-97699901 CCCTGAATTTTTAAGGGATGGCA 0: 1
1: 0
2: 1
3: 16
4: 157
Right 958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 200
958709475_958709477 20 Left 958709475 3:97699880-97699902 CCTGAATTTTTAAGGGATGGCAG 0: 1
1: 0
2: 2
3: 11
4: 135
Right 958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958709477 Original CRISPR TTGCCTCAGCCCAAGTTCCC TGG Intronic
905953816 1:41975325-41975347 TAGCCTCAGGTCAGGTTCCCTGG - Intronic
906248264 1:44292254-44292276 TTCCCTCAGCCCAAGCTTCTTGG - Intronic
907386934 1:54132063-54132085 TTGCTTTAGACAAAGTTCCCAGG + Intergenic
908776450 1:67645682-67645704 TTGCAGCAGCCTAAGTCCCCAGG + Intergenic
910244383 1:85122964-85122986 TAGCCTCTGCCCCAGGTCCCAGG - Intronic
911290399 1:96050618-96050640 TATTCTCAGCCCAACTTCCCAGG - Intergenic
911660265 1:100493655-100493677 GTGACGCAGCCCAAGATCCCAGG - Intronic
913666068 1:121049891-121049913 TTGCCTCTGCACAAGTCTCCTGG - Intergenic
914017466 1:143833167-143833189 TTGCCTCTGCACAAGTCTCCTGG - Intergenic
914656077 1:149741699-149741721 TTGCCTCTGCACAAGTCTCCTGG - Intergenic
915960364 1:160261931-160261953 CTCCCCCATCCCAAGTTCCCAGG - Intronic
916619182 1:166477223-166477245 TTGCCTTTGCCTAAGTTCTCTGG + Intergenic
916680629 1:167101686-167101708 TTGCCTCAGCCTAAGTAGCTGGG - Intronic
916710275 1:167399344-167399366 TTTCCCCAGCCCAACTTCACTGG + Exonic
916749906 1:167714404-167714426 TTTCCTCAGCCCGGGCTCCCGGG + Intergenic
919725597 1:200880846-200880868 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
919892529 1:201986038-201986060 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
920095597 1:203484477-203484499 CTTCCTCAGCCCCAGTTCCTTGG + Intronic
920254719 1:204646582-204646604 TTGCCTGAGTCCCAGCTCCCAGG - Intronic
920282459 1:204854337-204854359 ATGTCTCACACCAAGTTCCCAGG - Intronic
924768405 1:247055320-247055342 TGGCCCCAGGCCAAGGTCCCAGG + Intronic
1064205525 10:13320713-13320735 TTGCCTCAGCCCGAGTAGCTGGG - Intronic
1069487890 10:68836571-68836593 GTGCCTCAGCCCAGGTCCCAAGG + Intronic
1069726083 10:70579918-70579940 TTGCCTCAGCTCAATTCCACTGG - Intergenic
1070982798 10:80663206-80663228 TTTTCTCAGCCCTAGTTCCCTGG + Intergenic
1073180596 10:101580736-101580758 CTGCCCCAGCCCACGTGCCCAGG + Intronic
1073402654 10:103271641-103271663 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
1075723829 10:124601804-124601826 TTGCCTCAGGCCTGGCTCCCCGG + Intronic
1076994378 11:291006-291028 CTGCCCCAGCCCAAGGCCCCAGG + Exonic
1078579828 11:12530220-12530242 TTGTCTCAGCCCAGAATCCCAGG + Exonic
1085031391 11:73272947-73272969 TTCCCTCAACCAAAGTTCCTGGG - Intronic
1088708989 11:112489520-112489542 TTGGCTCAGCACAAGGTGCCTGG - Intergenic
1089060914 11:115625557-115625579 TTGCCAAAGCCCATCTTCCCTGG + Intergenic
1089282682 11:117385450-117385472 TTGCCTCTGTGCAAGTTCACTGG + Intronic
1089595528 11:119576901-119576923 TAGCGTCAGCCAAAGTTCCAGGG + Intergenic
1089684762 11:120139578-120139600 TTGTCTCTGCCCTTGTTCCCAGG - Intronic
1091238124 11:134035025-134035047 TTGGCACAGCCCCAGTGCCCAGG + Intergenic
1091430255 12:427721-427743 CTGCCTCAGCCCAAAGTGCCGGG + Intronic
1091465074 12:677099-677121 GTTCCTCAGCCCCAGATCCCAGG - Intergenic
1093446716 12:19267845-19267867 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1093965548 12:25320922-25320944 TTTCCTGAGCCCAAGTTCAGGGG - Intergenic
1096003924 12:48153267-48153289 TTGACTCAACCCAAGATCACAGG - Intronic
1096974428 12:55691775-55691797 TTGCCTCATGCCATGCTCCCAGG + Intronic
1097000820 12:55875009-55875031 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
1100626586 12:96339812-96339834 ATGCCTCAGCCCAAGTAGCTAGG - Intronic
1100678721 12:96895580-96895602 TTGCCTCAGCCTCAGTCTCCCGG - Intergenic
1101477526 12:105064733-105064755 TTGACTCAGCCCAGGCTCTCAGG - Intronic
1101836099 12:108296441-108296463 TAGCCTCATCCCACCTTCCCAGG - Intronic
1101923139 12:108949381-108949403 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
1102244346 12:111345664-111345686 TTGGCTCACCGCAAGCTCCCGGG - Intronic
1103581567 12:121918942-121918964 TTGACTGAGCCCAACTTCGCCGG - Intronic
1103739132 12:123079460-123079482 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
1103942597 12:124509130-124509152 ATGCCACACCCCAATTTCCCTGG + Intronic
1106518204 13:30473188-30473210 CTGCCTCAGCCCGAGTTTTCCGG + Intronic
1107372520 13:39768227-39768249 TTGCCTCAGCTGGAGTGCCCTGG + Intronic
1110345234 13:74439570-74439592 TTTCCTGAGCCCCAGTTCCCAGG + Intergenic
1112722293 13:102258637-102258659 ATCCCTGAGCCCAAGCTCCCTGG + Intronic
1113435298 13:110286530-110286552 CTGCCTCAGCCCCATTTTCCTGG - Intronic
1113742375 13:112720475-112720497 TTGCCTCAACCCAGGCTCACGGG - Intronic
1113758249 13:112829158-112829180 TTGCTTCAGGCCAAGTTAGCAGG + Intronic
1115982738 14:39071749-39071771 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1118350545 14:64970429-64970451 ATGGCTCAGCCCAAGCTCCTGGG + Intronic
1118836550 14:69482423-69482445 TTGCCTCAGGCCTGGCTCCCTGG - Intergenic
1119856931 14:77907948-77907970 TTGACCAAGCCCACGTTCCCCGG - Intronic
1122071513 14:99208324-99208346 TTCCCTGAGCCCCAGATCCCAGG + Intronic
1124031534 15:26016691-26016713 TTGCCTCAGCCCGAGTAGCTAGG + Intergenic
1129717247 15:77859639-77859661 CTGCCTCTGCCACAGTTCCCTGG - Intergenic
1130461787 15:84164660-84164682 CTGCCTCTGCCACAGTTCCCTGG + Intergenic
1131919180 15:97303973-97303995 TTGCTTCAGCCCAGGTCCCGAGG - Intergenic
1132657988 16:1049235-1049257 TTGCCCCTGCCCAGGTCCCCAGG - Intergenic
1134362274 16:13542636-13542658 TTGCCTCACCCCTATTTCCCAGG + Intergenic
1134586128 16:15412686-15412708 CTGCCTCAGCCCAAGTAGCAGGG + Intronic
1136230616 16:28883309-28883331 CTCCCTCTGCCCAAGCTCCCTGG - Intronic
1137440934 16:48498080-48498102 GTGCCTTAGCCCAGGTTCCTGGG + Intergenic
1138386558 16:56639348-56639370 TTGGCTCAGCCCCAGATTCCTGG - Intronic
1138555921 16:57771152-57771174 GTGCCTCAGCCCAAGGCCCCTGG - Intronic
1140138267 16:72228125-72228147 CTGCCACAACCCAAGTTGCCTGG - Intergenic
1140552621 16:75883379-75883401 CTGCCCCTGCCCAAGTTACCTGG - Intergenic
1141756282 16:85993302-85993324 TCTCCTTAGCCCAAGTTTCCGGG + Intergenic
1142618842 17:1152974-1152996 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1144459121 17:15443491-15443513 TTGCCTGATCTCAAGTTCCTGGG + Intronic
1144771163 17:17760436-17760458 TTGGCTCAGCCCAGTGTCCCTGG + Intronic
1145276508 17:21434552-21434574 TTCCCTCAGCTCCAGTTCCTGGG - Intergenic
1145314347 17:21720445-21720467 TTCCCTCAGCTCCAGTTCCTGGG - Intergenic
1148521356 17:48278904-48278926 CTCCCTCAGCCCAGGTTTCCTGG - Intronic
1148527508 17:48355073-48355095 TTTCCTCAACCAAAGTCCCCTGG + Intronic
1149409012 17:56384581-56384603 TTGTCTCAGCCCAAAATCTCAGG + Intronic
1150659284 17:67061478-67061500 TGGCCTCTGCCCAGGTTCCTGGG + Intergenic
1152229107 17:79105863-79105885 GTGGCTCAGCCCAGGCTCCCAGG - Intronic
1153347462 18:4043464-4043486 TTAGCTCAGCCAAAATTCCCAGG + Intronic
1153523970 18:5977781-5977803 GTGCCCCAGCCCAAGTGCTCTGG - Intronic
1153556320 18:6317587-6317609 TTACATAATCCCAAGTTCCCTGG - Intronic
1157252075 18:46103971-46103993 TTGCCTCAGCTCATATTGCCAGG + Intronic
1157293979 18:46428607-46428629 TAGCCTCATTCCAAGTGCCCAGG - Intronic
1157653459 18:49361235-49361257 CTGCCTCAGCCCTACTTTCCTGG + Intronic
1159504793 18:69322062-69322084 TTTCCTCAGCCCAAGTATCTGGG + Intergenic
1160117208 18:76090465-76090487 TTGCCTCATCCCCACTTCTCAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161496925 19:4591525-4591547 CTGTCTCAGCCCAGGTTCCTTGG - Intergenic
1161575794 19:5053594-5053616 TGGCCCCAGCCCATGGTCCCTGG + Intronic
1161634332 19:5377713-5377735 TTGCCTCAGTCCTGATTCCCCGG - Intergenic
1161677298 19:5659027-5659049 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1161795434 19:6383608-6383630 GTGCCACAGCCCAAGTCCCCGGG - Intronic
1162294528 19:9804015-9804037 TTACCTCAGCCCAATAGCCCAGG + Intergenic
1163692615 19:18745653-18745675 TTCCTTCAGCCCCAGCTCCCTGG - Intronic
1164442521 19:28290123-28290145 TGCCCACAGCCCCAGTTCCCTGG - Intergenic
1164667561 19:30051647-30051669 CAGCCTCCGCCCAAGCTCCCAGG + Intergenic
926111848 2:10188696-10188718 ATGCCTCGGCCCAAGGCCCCAGG - Intronic
927828438 2:26326883-26326905 TTGCCTCAGCCCAAGTAGCTGGG + Intronic
929572546 2:43031856-43031878 TTGCCTCTTCCCATGGTCCCTGG + Intergenic
930116933 2:47726127-47726149 TTCCCTCAGCCACAGTTCCCTGG + Intronic
930441279 2:51410077-51410099 TTCCATCAGCCCCTGTTCCCTGG + Intergenic
932004648 2:67916132-67916154 TAGATTCAGCACAAGTTCCCAGG + Intergenic
933700373 2:85251026-85251048 TGGCCTCAGGCCATGTTCTCAGG - Intronic
933796236 2:85922164-85922186 TTTCCTCTGCCCCACTTCCCCGG + Intergenic
935714721 2:105929759-105929781 ATGCCTCAGCCCCAGCTTCCTGG + Intergenic
935746864 2:106196358-106196380 CTGCCTACGCCCAAGATCCCCGG - Intergenic
937348635 2:121144282-121144304 TTGCCTCAGGCGAAATTCTCAGG - Intergenic
940331893 2:152484246-152484268 TTGCCTCAGTCCAAGGTCTTGGG + Intronic
942189484 2:173456267-173456289 TGGCTTCAGCCCAGGTGCCCTGG + Intergenic
946764014 2:223023319-223023341 TTGCCTAGGCCCAAGCTTCCAGG - Intergenic
947349004 2:229223068-229223090 TTGCCTCAGGACAAATTCCCAGG + Intronic
1169677809 20:8174053-8174075 ATTCCTCAGCCCAATTCCCCTGG - Intronic
1170164137 20:13344685-13344707 TTCCCTGAAGCCAAGTTCCCCGG + Intergenic
1170569825 20:17626456-17626478 AGGCCACAGCCCATGTTCCCTGG - Intronic
1171100601 20:22380121-22380143 TTGCATCACACCAAGTTCCAAGG + Intergenic
1171326878 20:24302574-24302596 TAACCTCAGCCCTAGCTCCCAGG + Intergenic
1173233342 20:41220202-41220224 AGGCCTTACCCCAAGTTCCCCGG - Intronic
1175126364 20:56754900-56754922 ATGTCTCAGCCCAAGTTCAAAGG - Intergenic
1175231046 20:57473504-57473526 TTGCCTGAGCTCTAGCTCCCAGG + Intergenic
1181592105 22:23891850-23891872 TTGGCTCAGCCTTAGTTCCTTGG - Intronic
953022756 3:39126252-39126274 TTCCCACAGCCCAGGTTACCAGG + Exonic
953389083 3:42524214-42524236 CTTCCTCAGCCCCAGTTCCAGGG - Intronic
953527778 3:43708452-43708474 TTGCACCAGACCAAGGTCCCAGG - Intronic
953732094 3:45458572-45458594 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
954574928 3:51670879-51670901 TCTCCTCAGCCCCAGCTCCCTGG + Intronic
955271674 3:57505827-57505849 TTGCTTGAGCCCAGGATCCCAGG - Intronic
956508185 3:69965047-69965069 TGGCCTCAGTCCCAGTTCCGAGG - Exonic
957572660 3:81968358-81968380 TTTCCTCAGCCCATGGTACCTGG + Intergenic
958709477 3:97699923-97699945 TTGCCTCAGCCCAAGTTCCCTGG + Intronic
958890333 3:99775755-99775777 TTTCCTCAGTCCCAGTTCCTTGG + Intronic
959021644 3:101193897-101193919 TTTCCACAGCCCAAGACCCCAGG + Intergenic
959886525 3:111508587-111508609 TTGCCACAGCCTAACTTACCTGG + Intronic
959897832 3:111625177-111625199 TTGCCTAAGGACAAGTTCCCAGG - Intronic
962954321 3:140250220-140250242 TTCACTCAGCACAAGTTCACTGG + Intronic
968340966 3:197955336-197955358 TTGCCTCACTGCAAGCTCCCAGG + Intronic
973611727 4:52642112-52642134 GTGACTCAGCCCAAGATCTCAGG + Intronic
973699810 4:53525566-53525588 GTGCCTCAGTCGAAGTTCACTGG + Intronic
975745905 4:77473571-77473593 CTGTTTCAGCCCACGTTCCCTGG - Intergenic
976929213 4:90544052-90544074 TTCCCTGAGCCCCAATTCCCAGG + Intronic
982027410 4:151264356-151264378 TTGGCTCACCCCCAGCTCCCAGG - Intronic
985280686 4:188283106-188283128 TTGGCTCAGCCCCAGGGCCCTGG + Intergenic
989588475 5:43091935-43091957 TTGCCTCAACCCTTGTTGCCTGG - Intronic
990198068 5:53341416-53341438 CTGCTCCAGCCCTAGTTCCCAGG - Intergenic
990407338 5:55504251-55504273 CTGCCTCAGCCTAAGTTGCTGGG - Intronic
990714138 5:58617644-58617666 TGGCCTCTGCCCAAGATGCCAGG + Exonic
991359987 5:65809856-65809878 TTGCCTCAGACAAAATTCCGGGG - Intronic
992660037 5:78950314-78950336 TTTCCTCAGCCCAGCTTCTCTGG - Intronic
996188563 5:120510902-120510924 TTGCCTCATCCCTACTTGCCTGG + Intronic
997885636 5:137627589-137627611 TTGGCTTAGCCCAACTTCCCAGG - Intronic
999153178 5:149440330-149440352 GTGCCTGGGCCCAAATTCCCAGG + Intergenic
1001058322 5:168467504-168467526 TTGCTGGAGCCTAAGTTCCCTGG + Intronic
1002588224 5:180266698-180266720 CTGCCTCAGCCCAAGTAGCTGGG + Intronic
1003243480 6:4364922-4364944 TTGCCTCAGGTCAGGGTCCCTGG + Intergenic
1004023834 6:11799657-11799679 TTCCCTCAGCCACAGTTCCCTGG + Intronic
1006656554 6:35598853-35598875 GTGCCTCAGCCCAAGTAGCTGGG - Intronic
1007177508 6:39906866-39906888 GTGCCTTAGCCCAGGTTCCTGGG - Exonic
1007995283 6:46301383-46301405 TCACCTCTGGCCAAGTTCCCAGG - Intronic
1010614814 6:77999798-77999820 ATGGCTCAGTCCAAGCTCCCAGG - Intergenic
1012545148 6:100411130-100411152 TGGGCTCAGCCCTAGTTCCAGGG - Intronic
1013680049 6:112514974-112514996 TTAACTCAGCTTAAGTTCCCTGG - Intergenic
1014934920 6:127375941-127375963 CTGCCTCAGCCCAAGTAACTGGG + Intergenic
1016910422 6:149193148-149193170 TTGCCTTAGGTCAAGTTCCCTGG - Intergenic
1018576620 6:165266430-165266452 ATGTCTCAGCTCAAGTTCCCAGG - Intergenic
1019856391 7:3612718-3612740 TTGCCACAGCTGAATTTCCCAGG - Intronic
1022214467 7:28244490-28244512 TTGCCTCAACTCAAGTGACCTGG + Intergenic
1022580935 7:31553440-31553462 ATCCCTCATCCTAAGTTCCCAGG + Intronic
1024596520 7:50941859-50941881 TAGCCTGAGCCTAAGCTCCCAGG - Intergenic
1024655600 7:51449027-51449049 CTGCCTCAGCCCAAGTAGCTGGG + Intergenic
1024843213 7:53611752-53611774 TACCCTCAGCCCATTTTCCCAGG + Intergenic
1028981248 7:96970247-96970269 TTGCCTAAGCCCATGTTCGGAGG - Intergenic
1032090520 7:128909472-128909494 TTGCTTTGTCCCAAGTTCCCTGG + Intronic
1034356199 7:150452160-150452182 TTCCCTCTGCTCAATTTCCCAGG - Intronic
1034949046 7:155284709-155284731 TGTCCTCAGTCCAGGTTCCCAGG - Intergenic
1037258306 8:16979796-16979818 TGGCCTCAGCCCCCGTTCCAGGG + Intergenic
1037734755 8:21556898-21556920 TGCTCTCTGCCCAAGTTCCCTGG - Intergenic
1039490322 8:37942550-37942572 TTGCCTCAAAACAGGTTCCCTGG - Intergenic
1039815650 8:41092452-41092474 TTTCCAAAGCCCGAGTTCCCAGG + Intergenic
1041162700 8:55061236-55061258 CTGCCTCAGCCCCAGTGCCCTGG + Intergenic
1041928833 8:63265953-63265975 CTGGCTCAGCACAATTTCCCTGG + Intergenic
1042852279 8:73227721-73227743 TTGCCTAAGGACATGTTCCCAGG - Intergenic
1047006081 8:120621837-120621859 TTGACTCAGACCAAGTGCCTGGG + Intronic
1047436018 8:124835909-124835931 ATGCCTCAGCCCAGCCTCCCTGG - Intergenic
1047514905 8:125545348-125545370 TTGCCAAAGTCCAAGTTCTCTGG + Intergenic
1048547522 8:135401593-135401615 TTGCATCCTCCCAAGGTCCCTGG + Intergenic
1053053705 9:34981185-34981207 TGCCCTCAGCCCAAGTACCTGGG + Exonic
1054891848 9:70259610-70259632 TTGCCTCCTCTTAAGTTCCCGGG - Intronic
1055296688 9:74840496-74840518 CTGCCTCACCCCAGGTTCTCTGG - Intronic
1055503988 9:76929855-76929877 TTCCCACAGCCCAAATTCCTGGG - Intergenic
1057019524 9:91685686-91685708 GTGGCTCAGCCCAAGTCCCGAGG - Intronic
1057023012 9:91715186-91715208 TTTTCCCAACCCAAGTTCCCAGG + Intronic
1057385256 9:94600893-94600915 ATGTCTCACACCAAGTTCCCCGG - Intergenic
1057407066 9:94782075-94782097 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1060783349 9:126430119-126430141 TAGCCTCAGCCCAGTTGCCCAGG + Intronic
1060817054 9:126640558-126640580 TGTCCTCTTCCCAAGTTCCCAGG + Intronic
1061186674 9:129059071-129059093 TTCCCTCACCCCCAGGTCCCTGG - Intronic
1061399840 9:130362237-130362259 CTCCCTCACCCTAAGTTCCCAGG - Intronic
1062697236 9:137881635-137881657 CTCCCTCAGCCCAGCTTCCCGGG + Intronic
1187310143 X:18133950-18133972 TTGCGGCAACCCAAGGTCCCAGG - Intergenic
1187335332 X:18376595-18376617 TTGCCTCAGCGCAGCCTCCCAGG + Intergenic
1187470668 X:19566718-19566740 TTGCATCAGCCCAAGCTATCAGG + Intronic
1194443980 X:93965469-93965491 TTCCTTCAGCCCATGTTCCCTGG + Intergenic
1194729732 X:97439455-97439477 CTGCCTCAGCCCAAGTAGCTGGG - Intronic
1195736763 X:108019675-108019697 CTGCCTCAGCCCTAGTTGCAGGG + Intergenic
1197605662 X:128582282-128582304 TGGTCTCTGCCCAAGGTCCCGGG + Intergenic
1198661582 X:138974449-138974471 TTGCCTGAGCCCTTGTTTCCAGG - Intronic