ID: 958712677

View in Genome Browser
Species Human (GRCh38)
Location 3:97737139-97737161
Sequence CTGGACTTCTTTAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958712677_958712685 12 Left 958712677 3:97737139-97737161 CCATCTTCCCTAAAGAAGTCCAG 0: 1
1: 0
2: 2
3: 27
4: 261
Right 958712685 3:97737174-97737196 TAAAGGAAGGAAAGGCACTTTGG 0: 1
1: 0
2: 2
3: 47
4: 429
958712677_958712684 4 Left 958712677 3:97737139-97737161 CCATCTTCCCTAAAGAAGTCCAG 0: 1
1: 0
2: 2
3: 27
4: 261
Right 958712684 3:97737166-97737188 GGAAGCAGTAAAGGAAGGAAAGG 0: 1
1: 0
2: 25
3: 571
4: 5204
958712677_958712681 -5 Left 958712677 3:97737139-97737161 CCATCTTCCCTAAAGAAGTCCAG 0: 1
1: 0
2: 2
3: 27
4: 261
Right 958712681 3:97737157-97737179 TCCAGCACAGGAAGCAGTAAAGG 0: 1
1: 0
2: 1
3: 22
4: 234
958712677_958712683 -1 Left 958712677 3:97737139-97737161 CCATCTTCCCTAAAGAAGTCCAG 0: 1
1: 0
2: 2
3: 27
4: 261
Right 958712683 3:97737161-97737183 GCACAGGAAGCAGTAAAGGAAGG 0: 1
1: 1
2: 0
3: 37
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958712677 Original CRISPR CTGGACTTCTTTAGGGAAGA TGG (reversed) Intronic
901551544 1:9998871-9998893 ATGGCCTGCTTCAGGGAAGAGGG + Intronic
902613326 1:17609856-17609878 ATGCACTGCTTTAGGGAAGGGGG + Intronic
902632136 1:17711262-17711284 CTAGACTTCTTTTGGGATCAGGG - Intergenic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
907418221 1:54329112-54329134 CTGGACTTCTGGAAGGAAGGGGG + Intronic
907937360 1:59054550-59054572 AAGGACTTCTTTGGGGAAGTGGG + Intergenic
908692909 1:66802913-66802935 CTGTTCTTCTGTAGGGAAGCTGG + Intergenic
908873425 1:68641644-68641666 GTGAACTTCTTTTGTGAAGAGGG + Intergenic
909436546 1:75648594-75648616 ATGGCCTGCTTTAGGAAAGAAGG + Intergenic
910169287 1:84360417-84360439 CTGGGCTTGTTAAGGAAAGAAGG - Intronic
910777392 1:90890974-90890996 CTGGACTTCTTCAGGGCTAAAGG - Intergenic
911048704 1:93651202-93651224 TAGGACTTCTGTATGGAAGAAGG + Intronic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
914773474 1:150713577-150713599 CTGGACTTCATTATGCAAGTTGG + Intronic
915369340 1:155334803-155334825 CTGGACTACGTTAGGCAACACGG + Intergenic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
916354877 1:163893729-163893751 TTGGCCTGCTTCAGGGAAGAAGG + Intergenic
916692066 1:167199888-167199910 CTGGAATTCTGTACTGAAGAGGG - Intergenic
917164056 1:172091599-172091621 CTGGAACTCTTCAGGGAACAAGG + Intronic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
918898706 1:190383462-190383484 CTGGAAATTTTTAGGGAACAAGG - Intronic
919212648 1:194508751-194508773 CTTGACTTCTTTAGAGATTATGG + Intergenic
919340461 1:196300439-196300461 ATGGCCTGCTTCAGGGAAGAAGG - Intronic
920207778 1:204305444-204305466 CTGCAATCCTGTAGGGAAGATGG - Intronic
920926172 1:210343767-210343789 CTGGACCTCTTTCAGGAAGTTGG - Intronic
921160229 1:212467183-212467205 CAGGCCTTCTGTAGGGAGGATGG - Intergenic
922413667 1:225399750-225399772 CTGCACTTCTTTAAAGAGGAAGG - Intergenic
922691524 1:227696005-227696027 CTGGACTTCCAAAGGAAAGATGG - Intergenic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923241196 1:232087295-232087317 ATGGTCTGCTTTAAGGAAGAAGG + Intergenic
1062913531 10:1230229-1230251 CTGGGCTTCTTTTGGGAATGTGG + Intronic
1063114459 10:3064103-3064125 CAGGACTCCTTTAGGGCACATGG + Intergenic
1063733575 10:8725982-8726004 CTGGACTTCAAAAGGGAAGAGGG + Intergenic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1070650809 10:78234835-78234857 CAGGACTTCTGTAGGCAAAATGG - Intergenic
1071892935 10:90031835-90031857 GTAGACTGCTTTAGGCAAGATGG - Intergenic
1071908277 10:90199632-90199654 TTGGCCTTCTTTAGGGAATAGGG - Intergenic
1073610270 10:104936318-104936340 CTGGACTCCTATAGTGTAGAAGG + Intronic
1073798706 10:107017603-107017625 GTGGTCTGCTTTGGGGAAGAAGG - Intronic
1074546022 10:114403334-114403356 CAAGACTACTTTAGGGAAGCCGG + Intronic
1074549218 10:114427503-114427525 CTGGTCTCCTGTGGGGAAGAAGG + Intergenic
1075482618 10:122795758-122795780 CTTTACTTCTTTGGAGAAGAAGG - Intergenic
1075934596 10:126328728-126328750 CTGGAATTCTTTAGTGCAGTAGG + Intronic
1076305095 10:129460762-129460784 CTCTACTGCTTTGGGGAAGATGG + Intergenic
1077666880 11:4119458-4119480 CTTGATTTCTTTTGGGAAAAAGG + Intronic
1078545435 11:12243614-12243636 CTGGGCTGCTTTAGGGCAGGTGG - Intronic
1080508148 11:32938880-32938902 CTGGGCTCTTTTAGGCAAGATGG + Intronic
1083053744 11:59800171-59800193 CTTGACTTTGTTAGGGAACATGG - Intronic
1084884529 11:72195112-72195134 TGGGACCTCTTTAGGGGAGAGGG - Intronic
1085531518 11:77194860-77194882 CTGGAGTTCTTTTAGGAAAAAGG - Intronic
1086685559 11:89730120-89730142 CTGGACTACTTGAGGGTGGAGGG + Intergenic
1088063374 11:105685104-105685126 CTGGATTCCTTTAGGAAGGAAGG + Intronic
1089118964 11:116118466-116118488 CTGGGCTTCTTTCAGGAGGAGGG - Intergenic
1089232729 11:116993795-116993817 CTGTACATCTTTTGGGATGAAGG - Intronic
1091296328 11:134476327-134476349 CTGGAAACCTTTAGGGAAAAGGG + Intergenic
1091297643 11:134485317-134485339 ATTGAATTCTTTGGGGAAGAAGG - Intergenic
1091864422 12:3819096-3819118 AGGGACATCTTTAGGGATGATGG - Intronic
1092128735 12:6093639-6093661 CTGGACTCCTGTGGGGAACAGGG - Intronic
1092965715 12:13640045-13640067 CTGCACTTCCTTGAGGAAGAGGG + Intronic
1098209110 12:68144015-68144037 CAGGGCTTCTTTTGGGCAGATGG - Intergenic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101269079 12:103123971-103123993 CTGGACTTCTTCAAGTAAAACGG - Intergenic
1101899941 12:108784291-108784313 CTGGACTTCTCCAGGGGAAAAGG + Exonic
1104200817 12:126586871-126586893 CAGGGCTTCTTTAAGGAAAAGGG + Intergenic
1106112983 13:26793109-26793131 ATGGCCTGCTTTAGGGGAGAAGG - Intergenic
1106925092 13:34605481-34605503 ATGACCTTCCTTAGGGAAGAAGG - Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1109623153 13:64936837-64936859 CTTGACTTAATTGGGGAAGAAGG + Intergenic
1116819162 14:49610964-49610986 CTGAACTTTTTTAGGGGAGAGGG + Intronic
1116994384 14:51307164-51307186 CTGTCCTTCTATAGGGATGAAGG - Intergenic
1117301523 14:54433896-54433918 CTGGACTCCTTTTGAGGAGAAGG - Intronic
1117902288 14:60547525-60547547 CTTGATTTCTTTGGGGAATAAGG + Intergenic
1118035052 14:61857548-61857570 CTGGAGTTGGTTAAGGAAGAGGG + Intergenic
1119537656 14:75416058-75416080 CTTGACTACTTAAGAGAAGAAGG - Intergenic
1119682989 14:76606768-76606790 CAGGAGTTGTTTAAGGAAGAGGG + Intergenic
1119961851 14:78867565-78867587 CATGACTGCTTCAGGGAAGAAGG - Intronic
1121834672 14:97081094-97081116 ATGAACTTTTTTGGGGAAGAGGG + Intergenic
1122413146 14:101536104-101536126 CTGGGCCTCCTTAGGAAAGAAGG + Intergenic
1122743421 14:103884825-103884847 CTGGGTTTCTTTACAGAAGAGGG + Intergenic
1125672122 15:41481181-41481203 CTGCCCTTCTTTTTGGAAGAAGG + Exonic
1125713660 15:41806523-41806545 CTGGACCTGTGTAGGGAAGGGGG + Intronic
1126473438 15:49041517-49041539 CTGGACTGGGTTAGGGAAAATGG + Intronic
1127044548 15:55011856-55011878 CTGGAGATTTCTAGGGAAGAGGG - Intergenic
1127106159 15:55618652-55618674 CTTGAATTCTTTAGAGAATATGG - Exonic
1127211209 15:56776789-56776811 CTGGTTTGCTTTAGGGAAGAGGG - Intronic
1128221343 15:65970782-65970804 CTGAACTTCTTCTGGGAAGTTGG - Intronic
1129081806 15:73047902-73047924 CGGGTCTACTTTAGGGTAGAGGG - Intergenic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1130912192 15:88278442-88278464 CTGGACTTCCTTCTGGAATATGG + Intergenic
1133971010 16:10568009-10568031 CTGGGCTTCCTGAGGCAAGACGG - Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1137943421 16:52710859-52710881 CTGGACCGCTCAAGGGAAGACGG + Intergenic
1138174451 16:54884166-54884188 ATGGCCTGCTTTGGGGAAGAAGG - Intergenic
1140555444 16:75916081-75916103 CCTGACTTGTTTAGGCAAGAAGG - Intergenic
1140801585 16:78493131-78493153 CTGGACTTCTTCCTGGGAGAAGG + Intronic
1140951239 16:79819745-79819767 TGGGTCTTCTTTAGTGAAGATGG - Intergenic
1142135799 16:88451581-88451603 GTGGACTTCTTTGGGGAAGGAGG + Intergenic
1143167075 17:4902142-4902164 CTGGACTTGGTTGGGGAAGGGGG - Exonic
1144418322 17:15072402-15072424 TTGGCCTGCTTCAGGGAAGAAGG - Intergenic
1150047606 17:61928526-61928548 CGGCACTTCTTCTGGGAAGAGGG + Intergenic
1151546107 17:74794158-74794180 CTGGAATCATTTATGGAAGATGG + Intronic
1152114829 17:78378977-78378999 CTGGCCTTCTTGAGGGAGGGTGG + Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1155091718 18:22517964-22517986 CTGGCCTCCCTTAGGGGAGAAGG - Intergenic
1156596571 18:38554499-38554521 ATGGCCTGCTTCAGGGAAGAAGG - Intergenic
1156689809 18:39693843-39693865 CTGAGCTGCTTTAGGTAAGAGGG + Intergenic
1159320765 18:66845040-66845062 GGGGACTGCTATAGGGAAGAAGG + Intergenic
1161989175 19:7674422-7674444 CTGGACTTCCTTTGAGAAAAAGG - Intergenic
1162625612 19:11882199-11882221 TTGGAGTTCTTTAGGGGAGAGGG - Intronic
1162794294 19:13078615-13078637 CCTGACTTCTTTAGAGAAGCCGG - Exonic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
926830211 2:16953760-16953782 TTGGACTTCTTTGGAGCAGATGG + Intergenic
928887166 2:36163013-36163035 CTGGACTTCTTGAAATAAGAAGG + Intergenic
929632930 2:43484369-43484391 AATGACTTTTTTAGGGAAGAAGG + Intronic
930332932 2:50008580-50008602 CTGGACTTTTCTAGGGAGGAAGG - Intronic
932339689 2:70954883-70954905 CAGGACTTTTTCCGGGAAGAAGG + Intronic
933510618 2:83236756-83236778 CTGGACTTTTTTAAAGATGAAGG + Intergenic
935242036 2:101187266-101187288 CTGAACTTCATAAGGGAGGAGGG + Intronic
937296601 2:120813282-120813304 CTGCATTGCTTTGGGGAAGAAGG + Intronic
937307311 2:120880386-120880408 CTGGACTTCGGTGGGGAAGATGG - Intronic
939878019 2:147599752-147599774 CTGGGCTTCTTTAGGTACGAGGG - Intergenic
940200845 2:151148720-151148742 GTGGAGTTCTTTGGGGAAGCTGG - Intergenic
940378908 2:152990752-152990774 CTGTACTTCTGTAGCTAAGATGG + Intergenic
941724093 2:168842170-168842192 GTGACCTTCTTTGGGGAAGAGGG + Intronic
942327369 2:174787437-174787459 GTGGACTTCTTTTTGGAATATGG - Intergenic
944994980 2:205283838-205283860 CTGGCTTACTTCAGGGAAGAGGG - Intronic
948149397 2:235733064-235733086 CTGCCCTTCTTTAGGGACCAGGG + Intronic
1169501566 20:6165712-6165734 CTGGTCATGGTTAGGGAAGAGGG + Intergenic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1170523019 20:17207779-17207801 CTTGTCTTCTTAAGGGAAGCTGG + Intergenic
1170750983 20:19144847-19144869 GTGAACATCTTTAGGGAAGGGGG - Intergenic
1171092208 20:22296005-22296027 CTGAATGTCTTTAGGGGAGATGG + Intergenic
1171430508 20:25081022-25081044 CTGGATTTCTTTGGGGAAATGGG + Intronic
1172323744 20:34018289-34018311 CTAGACTTCTGTGGGGGAGAAGG + Intronic
1173469027 20:43308323-43308345 CTGAACTTCTTAAGGGGAGGAGG + Intergenic
1174197572 20:48784618-48784640 AGGGGCTTCTTTAGGGAAGAGGG - Intronic
1175092994 20:56520172-56520194 CTGGCCAGCTTGAGGGAAGAAGG + Intronic
1175592389 20:60203561-60203583 CTGGACCTCTGTGGGCAAGAAGG + Intergenic
1175626963 20:60496862-60496884 CTTGACTTCTTTATGGAATTTGG - Intergenic
1178662741 21:34521041-34521063 CTGGCCTTCTTAAAGGAAAAGGG - Intronic
1179481001 21:41678657-41678679 CTGGACTTCTCCAGGGCAGGCGG + Intergenic
1180758925 22:18183955-18183977 CTGGGCTCCTTTTGGGAAGGAGG - Intergenic
1180769212 22:18367746-18367768 CTGGGCTCCTTTTGGGAAGGAGG - Intergenic
1180777100 22:18494649-18494671 CTGGGCTCCTTTTGGGAAGGAGG + Intergenic
1180809817 22:18751958-18751980 CTGGGCTCCTTTTGGGAAGGAGG + Intergenic
1181195960 22:21186210-21186232 CTGGGCTCCTTTTGGGAAGGAGG + Intergenic
1181213568 22:21306914-21306936 CTGGGCTCCTTTTGGGAAGGAGG - Intergenic
1181524257 22:23470225-23470247 CTGGGCTCCTTTTGGGAAGGAGG - Intergenic
1182058820 22:27382205-27382227 CTGGATTCCTTTAGGGTAGAAGG + Intergenic
1182085381 22:27557597-27557619 CTTTTCTTCTTTAGGGAGGAAGG - Intergenic
1182435054 22:30325274-30325296 CTGGATTTCTCCAAGGAAGAAGG + Intronic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183310680 22:37107999-37108021 TTGGACTTCTGTAGGGAGGAAGG - Intronic
1203230841 22_KI270731v1_random:108631-108653 CTGGGCTCCTTTTGGGAAGGAGG - Intergenic
1203277229 22_KI270734v1_random:96880-96902 CTGGGCTCCTTTTGGGAAGGAGG - Intergenic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
950473439 3:13200675-13200697 CTGGGCTGCTTTCCGGAAGATGG + Intergenic
950553221 3:13680114-13680136 ATGGAATTCCTTAGGGAAGATGG + Intergenic
951174871 3:19587266-19587288 TTGAACTTATTTAGGCAAGATGG - Intergenic
951366226 3:21786365-21786387 CAGTACTCCTTTAGGGAAGTCGG + Intronic
954895321 3:53970261-53970283 CTGGACTGCTCCAGGGAAGATGG - Intergenic
956138600 3:66123523-66123545 ATGGACTACATTAGGGGAGAAGG - Intergenic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
959767818 3:110053871-110053893 CTGGACTTCTTTGAGCTAGACGG - Intergenic
959796282 3:110432421-110432443 CGGGACTTCTAGAGGGGAGAGGG - Intergenic
959908220 3:111733604-111733626 CTGGAGGTCTATGGGGAAGAAGG + Intronic
960053474 3:113259438-113259460 CTGGACTCCTTTAAGGAGCATGG + Intronic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961790050 3:129369109-129369131 CTGGGCTGCTTTCTGGAAGATGG - Intergenic
962432987 3:135337612-135337634 CTTGGCTTCATTAGAGAAGAAGG + Intergenic
962624102 3:137208313-137208335 CTTGACTGCTTTAGGGCGGATGG + Intergenic
963206512 3:142641764-142641786 CTGGGTTTCTTTAGGGGAGATGG + Intronic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968140643 3:196253396-196253418 CTGGACTTGTTTAGGGAAAATGG - Intronic
968661116 4:1799239-1799261 CGGGACTTCTGTGGGGAAGATGG - Exonic
970224116 4:13839324-13839346 ATGGACATCTTTAGGGATGGAGG + Intergenic
970369801 4:15395254-15395276 CTGGGGTGATTTAGGGAAGAGGG + Intronic
971607518 4:28676931-28676953 CTGAACTGCCTTGGGGAAGAAGG + Intergenic
975864533 4:78713369-78713391 ATGACCTTCTTTGGGGAAGAGGG - Intergenic
977734743 4:100399916-100399938 TGGGACTTCTTGAGGGTAGAGGG - Intronic
979350836 4:119642858-119642880 CTGCACTTTCATAGGGAAGAAGG - Intergenic
979602716 4:122603957-122603979 CTGGACTCCTTTAGGTTAAATGG + Intergenic
980232063 4:130057797-130057819 CAGGACTCCTTTAGGTAAGATGG - Intergenic
980840249 4:138250770-138250792 GGGGACTACTTTAGAGAAGAGGG + Intergenic
981107144 4:140893938-140893960 ATGGACTTGTTTAGGGAATTTGG - Intronic
981764250 4:148229854-148229876 CTAGAGTTCTTTAGGGAAGGGGG - Intronic
982854087 4:160359422-160359444 CTGGACTTCTGTTGGCTAGATGG - Intergenic
983644717 4:169978031-169978053 CTGGACTTCTCTGAGGAAGTAGG + Intergenic
983907117 4:173195447-173195469 CAGGTTTTCTTTAGAGAAGATGG - Intronic
984519877 4:180788569-180788591 ATGGTCTGCTTCAGGGAAGAAGG + Intergenic
985284714 4:188323891-188323913 TTGGAATTATATAGGGAAGATGG + Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
988435324 5:31167695-31167717 ATGGCCTGCTTCAGGGAAGAAGG - Intergenic
988627391 5:32892213-32892235 TTGGTCTTCTTCTGGGAAGAGGG + Intergenic
989673654 5:43948896-43948918 ATGGAATTCATTAGGAAAGAAGG - Intergenic
990990506 5:61678967-61678989 CTTCACCTCTCTAGGGAAGAAGG + Intronic
992569790 5:78043585-78043607 CTGGTCTTCTTTAAGGTGGAGGG + Intronic
993747868 5:91624107-91624129 AGGGACTACTTGAGGGAAGAAGG + Intergenic
995421053 5:111967433-111967455 CTGCAATTCTTTAGGTGAGAGGG - Intronic
996324210 5:122253648-122253670 GTGGATTTCTTTAGGCAATATGG + Intergenic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
997949526 5:138231147-138231169 CTGGAATTCTTCCAGGAAGAAGG - Intergenic
999258253 5:150222007-150222029 CTGGAATTCTCCAGGGATGACGG + Intronic
1001274427 5:170339995-170340017 CTGGCCTAGTTTAGGGAAGCAGG - Intergenic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1003554467 6:7127539-7127561 TTGGAATTCTTTAGAGGAGAGGG + Intronic
1004072421 6:12312804-12312826 CTGGACTTCTCAAGGCAAAAAGG + Intergenic
1004811003 6:19263092-19263114 CATGACTTCTTTAGGTAAAAGGG + Intergenic
1005477814 6:26225510-26225532 CTGGATGTCTTTAGGCATGATGG - Exonic
1005508970 6:26495070-26495092 GTGGACTTCTGTGTGGAAGAGGG - Intergenic
1005577542 6:27204114-27204136 CTGACCTGCTTTAGGGGAGAAGG + Intergenic
1005834358 6:29696518-29696540 GTGGTCTTCCTTAGGGACGACGG + Intergenic
1005901083 6:30216736-30216758 GTGGCCTGCTTCAGGGAAGAAGG - Intergenic
1008096358 6:47343415-47343437 CTGGATTTCTATAATGAAGAAGG - Intergenic
1008384307 6:50870897-50870919 CTTGAATTCTTTAGGGAAAAGGG - Intergenic
1009738061 6:67704976-67704998 CATGTTTTCTTTAGGGAAGATGG - Intergenic
1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG + Intergenic
1010730682 6:79387603-79387625 CTGGACTTCTTGAGGCAATTGGG + Intergenic
1013079129 6:106797161-106797183 CAGGACTGCTTGAGGAAAGAGGG + Intergenic
1014110079 6:117610494-117610516 CTTGACTCCTTTGGGTAAGAGGG - Intergenic
1014901503 6:126971008-126971030 CTGGACAGCTTTAGAAAAGAAGG + Intergenic
1016899514 6:149087724-149087746 ATGTACTTCTTTTGGGAAGGGGG + Intergenic
1017441522 6:154468439-154468461 GTGGACTTTTTTAGGTTAGATGG - Intronic
1023520556 7:41046286-41046308 CTGGACTTCTGCACGGGAGAAGG + Intergenic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1026363477 7:69624771-69624793 CTGGTATACTTTTGGGAAGATGG - Intronic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1027112604 7:75452821-75452843 CTCCACCTCTTCAGGGAAGAGGG - Intronic
1027267824 7:76503856-76503878 CTGGACTTGTTCTGGGCAGAAGG + Intronic
1027284850 7:76637427-76637449 CTCCACCTCTTCAGGGAAGAGGG - Intergenic
1027319635 7:77003718-77003740 CTGGACTTGTTCTGGGCAGAAGG + Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028946535 7:96586257-96586279 CTGGAATTCTGTAGGAAAGAAGG - Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1030396743 7:108995500-108995522 ATGGCTTTCTTTGGGGAAGAAGG + Intergenic
1031429288 7:121646791-121646813 GTGGCCTTCTTTAGGGTGGAGGG - Intergenic
1032414715 7:131727271-131727293 CTGGCCTTCTTGTGGGAAGTGGG - Intergenic
1032871915 7:135994893-135994915 GTGGACTAATTTATGGAAGATGG + Intergenic
1034860593 7:154591768-154591790 CTGGGTTTCTTTAGGGGAAAAGG + Intronic
1036955516 8:13183944-13183966 CTGGACTTTTTTTGGAAAGTAGG + Intronic
1037073746 8:14686699-14686721 CTAGACTACATCAGGGAAGAAGG + Intronic
1038308689 8:26428076-26428098 CTGGAATTCTTTGGGAATGAAGG + Intronic
1039989802 8:42477776-42477798 AGGGACTTTTTAAGGGAAGAAGG + Intronic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1040555026 8:48470700-48470722 CTGAAGTTCTTTACAGAAGAGGG + Intergenic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1046231922 8:111369221-111369243 CTGACCTGCTTTGGGGAAGAAGG + Intergenic
1046474586 8:114725256-114725278 CTGGCCTACTTGAGGGAGGAGGG + Intergenic
1046474908 8:114729547-114729569 CTGGACTTTTTTAGGGAAAAGGG - Intergenic
1048028048 8:130604837-130604859 CTGGATCTCTTTTGGGAACATGG + Intergenic
1048616460 8:136080553-136080575 CTGGATTTCCTAATGGAAGAGGG - Intergenic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1050113447 9:2240322-2240344 CAGGTCTTCTTTAGGGGAGGGGG + Intergenic
1050651382 9:7780623-7780645 CTGGAAGTTTTTAGGAAAGAGGG + Intergenic
1051433639 9:17007011-17007033 CTGGACTTCATAAGGGAGGCAGG + Intergenic
1051490168 9:17654342-17654364 ATGGACTCCTCTAGGGAAGGGGG + Intronic
1052340849 9:27362857-27362879 CTGGACGTCTGTAAGGCAGAAGG - Intronic
1052935368 9:34088589-34088611 CTGGTCTCCTTAAGGGAACAGGG + Intronic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055423764 9:76171594-76171616 CAGAACTTCTTGAGGGCAGAGGG - Intronic
1056016035 9:82388800-82388822 CTGGACTTTTTTTGGTTAGAAGG + Intergenic
1058477927 9:105359203-105359225 CTGTACTACTTTATGGAAAAAGG - Intronic
1059551164 9:115231035-115231057 CTGGACTTCTTTTTGAAAAAGGG + Intronic
1060969921 9:127732091-127732113 CTGCTCGTCTTCAGGGAAGAAGG + Exonic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186039653 X:5461929-5461951 CTGGAATTCTTTGGGAAGGAGGG - Intergenic
1186885637 X:13910404-13910426 TTGGACTTCTTTTTGGATGAGGG - Intronic
1187733764 X:22283176-22283198 CTGGACTTCTTTAGTGTTGTTGG - Intergenic
1187776139 X:22760175-22760197 CTGGAGTTCTTAAAAGAAGAGGG + Intergenic
1188065592 X:25655794-25655816 CTCTACTTCTGTATGGAAGAAGG + Intergenic
1189298999 X:39938552-39938574 GTGGCCTTCTCTAGGAAAGATGG + Intergenic
1189635879 X:43008641-43008663 CTGGCCTGCTTCAGGGAAGAAGG + Intergenic
1189933864 X:46043934-46043956 ATGGCCTGCTTTAGGGGAGAAGG + Intergenic
1192164722 X:68820855-68820877 CAGGAGCTCATTAGGGAAGATGG - Intergenic
1193339692 X:80333503-80333525 CTCAACTTATTTATGGAAGAGGG + Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1194187871 X:90795460-90795482 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic
1195350312 X:103989482-103989504 CTGGACTTCTTTAGGTTGGTAGG - Intergenic
1195794694 X:108632342-108632364 CTGGACTTCTTTTGGGTGGTAGG - Intronic
1198638338 X:138725614-138725636 CTGTACTTCTTCAGGGAAGCTGG + Intronic
1198701976 X:139406588-139406610 CTGAACTTCTTAAGTGAAGCTGG - Intergenic
1199766428 X:150944950-150944972 ATGGACTTAAATAGGGAAGAGGG - Intergenic
1200534459 Y:4377409-4377431 ATGGAGTTCTTCAAGGAAGAGGG - Intergenic