ID: 958716404

View in Genome Browser
Species Human (GRCh38)
Location 3:97787766-97787788
Sequence GCTCCTAACCAGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958716397_958716404 2 Left 958716397 3:97787741-97787763 CCCACCTCACCCATCTTTGGTTA 0: 1
1: 0
2: 0
3: 13
4: 153
Right 958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 165
958716399_958716404 -2 Left 958716399 3:97787745-97787767 CCTCACCCATCTTTGGTTAAAGC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 165
958716401_958716404 -8 Left 958716401 3:97787751-97787773 CCATCTTTGGTTAAAGCTCCTAA 0: 1
1: 1
2: 0
3: 2
4: 123
Right 958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 165
958716398_958716404 1 Left 958716398 3:97787742-97787764 CCACCTCACCCATCTTTGGTTAA 0: 1
1: 0
2: 2
3: 21
4: 214
Right 958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 165
958716400_958716404 -7 Left 958716400 3:97787750-97787772 CCCATCTTTGGTTAAAGCTCCTA 0: 1
1: 1
2: 1
3: 6
4: 98
Right 958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 165
958716395_958716404 7 Left 958716395 3:97787736-97787758 CCAGTCCCACCTCACCCATCTTT 0: 1
1: 0
2: 1
3: 44
4: 425
Right 958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG 0: 1
1: 0
2: 0
3: 19
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958716404 Original CRISPR GCTCCTAACCAGAGGGCAGA TGG Intronic
900638411 1:3676604-3676626 ACTCCTCCCCACAGGGCAGAGGG + Intronic
902246006 1:15120798-15120820 GCTCCTCAGCAGAGCGCAGATGG + Intergenic
902341470 1:15786064-15786086 GGTCATAACCAGAGGACTGAAGG - Intronic
902866916 1:19285788-19285810 GCTGCTATGCAGAGGGCACAGGG + Intronic
903651445 1:24924922-24924944 GCTCTTAACAACAGGGCTGAAGG - Intronic
905463668 1:38137235-38137257 GCTCTCACCCAAAGGGCAGATGG - Intergenic
911639362 1:100270538-100270560 ACTCCTAAGGAGAAGGCAGAAGG - Exonic
912352651 1:109028908-109028930 GATTTTAACCAGAGGCCAGAAGG - Intronic
912718394 1:111999341-111999363 GCTGCTCACGAGAGGGCGGAGGG + Intergenic
919770742 1:201156717-201156739 GCTCATAAACACAGGGCACATGG - Intronic
920206331 1:204295022-204295044 GCTCCTAAGTACAGGGGAGAGGG - Intronic
922763934 1:228148113-228148135 GCCCCTAACCAGAGTCCTGATGG + Intronic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
923906621 1:238392128-238392150 GCTGCTTGCCAGAGGGCAGGTGG - Intergenic
924271215 1:242334542-242334564 GCTGCCTACCAAAGGGCAGAGGG - Intronic
1064453129 10:15461572-15461594 GATCTTAACCTGAGGGCAGAAGG + Intergenic
1065861848 10:29878479-29878501 TCTCCTAACCACAGGCAAGAAGG + Intergenic
1066713455 10:38261581-38261603 GCTGCCTACCAAAGGGCAGAGGG + Intergenic
1067215155 10:44295070-44295092 ACTCCTAACCAGAACGCACATGG + Intergenic
1068630374 10:59291443-59291465 GCTCCTGAACAGAGGGAAGCTGG - Intronic
1070804288 10:79261630-79261652 GCTCCAAGGCAGAGGGCTGAGGG + Intronic
1074598313 10:114887944-114887966 GCACCTAACCAGAAGTCAGAGGG - Intronic
1074759785 10:116658486-116658508 GCTGCCAAGGAGAGGGCAGATGG + Intergenic
1077221732 11:1420929-1420951 GCACCCAGCCAGAGGGCCGAGGG - Intronic
1078650480 11:13186236-13186258 AAACCTAACCAGAAGGCAGAGGG + Intergenic
1079445738 11:20554871-20554893 CCTCTTCACCAGACGGCAGAAGG + Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1081964673 11:47162262-47162284 GCTCCTAGGCTGAGGGGAGAAGG + Intronic
1083335246 11:61918111-61918133 AATACTATCCAGAGGGCAGATGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083839684 11:65297152-65297174 GCGCCTTACCAAAGGGCAGGTGG + Exonic
1084568381 11:69944428-69944450 GCTCCTAGCCGGGGTGCAGAAGG + Intergenic
1084683497 11:70680518-70680540 GATCCTCATCAGAGGGCAGGGGG - Intronic
1084734824 11:71097797-71097819 GCTGCTACCCAGCGGGCACAGGG + Intronic
1086897354 11:92328725-92328747 GCTGCAAACCTGAGGGCACATGG - Intergenic
1088919366 11:114250312-114250334 GCTTCTCACCTGAGGGCGGAGGG - Exonic
1091315931 11:134614072-134614094 CCTCCTTACCACAAGGCAGATGG - Intergenic
1094654682 12:32408935-32408957 GAACCTTCCCAGAGGGCAGATGG - Intronic
1095878250 12:47105165-47105187 GCTCCTATACAGAGGGGAGTGGG + Intronic
1100243265 12:92730896-92730918 ACTCCTGAGAAGAGGGCAGAGGG - Intronic
1104363234 12:128153479-128153501 GCTCCTAAACAGAAGACAGTGGG - Intergenic
1105294234 13:19074198-19074220 TCTCCGGACCAGTGGGCAGATGG + Intergenic
1105785019 13:23739996-23740018 TCTCCTAACCAGAAGGGAAATGG - Intronic
1113574608 13:111385734-111385756 GCTCCTCAACAGAGGGAGGAGGG + Intergenic
1123460238 15:20463769-20463791 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1123657824 15:22536648-22536670 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG + Intronic
1124311733 15:28631846-28631868 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1128426100 15:67543275-67543297 CCTCCTAACCAGCGGCCAGTGGG + Exonic
1128694280 15:69748640-69748662 CCCCCAAACCAGATGGCAGATGG + Intergenic
1130412994 15:83662915-83662937 TCTGCTACCCAGAGGGCAGAGGG - Intronic
1131247993 15:90812520-90812542 CCTACTAGCCAGAAGGCAGAGGG - Intronic
1131311747 15:91296750-91296772 GCTCCCAACGATCGGGCAGAAGG - Exonic
1131311777 15:91296917-91296939 GCTCCCAACGATCGGGCAGAAGG - Exonic
1131338785 15:91576245-91576267 GCTCCGAAGGAGGGGGCAGAAGG - Intergenic
1132864254 16:2085807-2085829 GCTTCTGAGCAGAGGGCACATGG + Intronic
1134359719 16:13520013-13520035 GCACCTATCCAGATGGAAGAAGG + Intergenic
1135122622 16:19779551-19779573 GCTGCTATCCAGATGGCAGATGG - Intronic
1135787563 16:25364013-25364035 GCTCCTATCCAGCAGGCAGAGGG + Intergenic
1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1136763260 16:32752462-32752484 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1138577181 16:57915456-57915478 GCTTAAAACTAGAGGGCAGAAGG + Intronic
1139551414 16:67675120-67675142 GCTCCTTGCCACAGGGCAGAGGG - Exonic
1141091015 16:81130403-81130425 GTTCCTAGCCAGAAGGCACAAGG + Intergenic
1141457652 16:84154525-84154547 GCTCCTACTCCCAGGGCAGAGGG - Intronic
1203065411 16_KI270728v1_random:1012784-1012806 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1142747493 17:1967144-1967166 GCTCCTCCCCAGAAGGAAGAGGG + Intronic
1143778931 17:9219329-9219351 GCTGCTATCCAGATGGCAGGAGG + Intronic
1143863673 17:9908875-9908897 GCTCCAGGCCAGAGGGCAGGAGG - Intergenic
1143879813 17:10021469-10021491 GCAGCTACGCAGAGGGCAGAAGG - Intronic
1145916934 17:28579742-28579764 CCTCCTAACCTGCGGGCTGAAGG + Exonic
1147304945 17:39556730-39556752 TCTCCTATCCATAGGGTAGATGG + Intronic
1148589463 17:48804988-48805010 GCCCCTAGAGAGAGGGCAGAGGG + Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151917390 17:77128300-77128322 GCGCCTGACCAGAGGCCACAGGG + Intronic
1152094571 17:78265742-78265764 GTTCCTAATCAGACGGCACATGG - Intergenic
1153944784 18:10009140-10009162 AGTCCAGACCAGAGGGCAGAGGG - Intergenic
1155168143 18:23247627-23247649 GCTCCTAACCAGTGTGCACTGGG + Intronic
1155368363 18:25071961-25071983 GCTGAGAACCAGAGGGCAGAAGG + Intronic
1158939634 18:62395173-62395195 CCTCAGAACCAGAGGGCTGATGG - Intergenic
1160078978 18:75704607-75704629 GGTCAAAACCAGAGGGCAGGTGG - Intergenic
1160316550 18:77853337-77853359 CCTCCTTAGCATAGGGCAGAGGG - Intergenic
1162019999 19:7863984-7864006 TCTCTTAACAGGAGGGCAGAGGG + Intronic
1162328812 19:10014294-10014316 TCTCTAAAACAGAGGGCAGAGGG - Intronic
1164551969 19:29219470-29219492 GCTCCTCCCCAGAGAGAAGAGGG - Intergenic
1166601084 19:44094976-44094998 TCTCCTAAAAAGAGGTCAGAAGG - Intronic
925766260 2:7238595-7238617 GCTCCTGAGGAGAGGGCAGCGGG - Intergenic
926797051 2:16627791-16627813 GCTGCTACCCAGAGGGCACTAGG - Intronic
927092878 2:19725911-19725933 GCTCCTAGTCAGTGGCCAGAGGG - Intergenic
927483569 2:23473242-23473264 GAACCTAACCAGAAGTCAGAGGG + Intronic
933177786 2:79195342-79195364 GCTGCTACCCAGAAGGAAGAAGG - Intronic
934758322 2:96839683-96839705 GCTCCTGACCCGAGGGCGGGTGG - Intronic
935120521 2:100180000-100180022 CCCTCTAACCAGAAGGCAGAGGG - Intergenic
935675197 2:105589235-105589257 GCCCCCAACCAGAAGGCAAAGGG - Intergenic
938366472 2:130738425-130738447 GAGCCTAACCAGAGGACAGCTGG - Intergenic
938650245 2:133375595-133375617 GGTGCCTACCAGAGGGCAGAGGG - Intronic
943658872 2:190536354-190536376 GCTGCTCCCCAAAGGGCAGAAGG - Intergenic
945024962 2:205611633-205611655 GCTCATTTCCAGAGGCCAGAAGG - Intronic
947356536 2:229301735-229301757 GCTCCTTTCCAGACGGCAGCTGG - Intergenic
948892551 2:240914575-240914597 GCTCCCAGCCAGAGGGTGGAGGG - Intergenic
949026807 2:241770186-241770208 GCCCCCAACCAGAGGTCAGAGGG - Intergenic
1169408694 20:5348607-5348629 GCACATACACAGAGGGCAGATGG + Intergenic
1169778286 20:9280246-9280268 TCTCCTTTCCAGAGGCCAGAAGG - Intronic
1170522823 20:17206029-17206051 GCTACTAACTAGGGGGCATAAGG - Intergenic
1171257147 20:23698026-23698048 GCTGCTAGCCACATGGCAGAGGG + Intergenic
1171264503 20:23759881-23759903 GCTGCTAGCCACATGGCAGAGGG + Intergenic
1172228233 20:33319646-33319668 GGTCCTGAGCAGATGGCAGAGGG + Intergenic
1172803088 20:37591891-37591913 GCTGCTGACCACAGGGCAGAGGG + Intergenic
1173328154 20:42052266-42052288 GCTTCTGAGCACAGGGCAGATGG + Intergenic
1173363409 20:42364575-42364597 GCTTCTAACCTGAGGCCAGAGGG - Intronic
1175655470 20:60766066-60766088 GCTCCAAACCTGAGAGCAGCTGG + Intergenic
1175758006 20:61542087-61542109 GCCCATACCCAGAGGGCAGCTGG + Intronic
1175825913 20:61936428-61936450 CCTCCCAACCCAAGGGCAGATGG - Intronic
1179392764 21:41008982-41009004 GCTCCCATCCAGAGGCCAGACGG - Intergenic
1179901839 21:44398281-44398303 GCTTGAATCCAGAGGGCAGAGGG - Intronic
1181283409 22:21735776-21735798 GCTCCAAAACAAAGGGCAGGCGG - Exonic
1182554119 22:31119796-31119818 ACTCCGAACCAAAGGGCAGGAGG + Intronic
1182560429 22:31154917-31154939 GACCCTCTCCAGAGGGCAGAGGG - Intergenic
1184174754 22:42782005-42782027 GCTTCAAAGCAGAAGGCAGAAGG - Intergenic
952225050 3:31366547-31366569 GGACCAAGCCAGAGGGCAGAGGG + Intergenic
958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG + Intronic
960621679 3:119643004-119643026 GCTGTTATCCAGAGGGCAGGTGG + Intronic
961546711 3:127639324-127639346 GCTCCAAGCCAGTGGGCAGCAGG - Exonic
962257468 3:133882374-133882396 CCTCCTCCCCAGAGTGCAGATGG - Intronic
962356032 3:134695051-134695073 GCTCCTGACCAGATAGCACAGGG + Intronic
963977291 3:151495707-151495729 GCATCTAGCCAGAGGGGAGAAGG + Intergenic
966004508 3:174993324-174993346 GCTCATAACCAGGGGGAACATGG - Intronic
967069847 3:185953061-185953083 GCTCTTAACACAAGGGCAGAGGG - Intergenic
967943731 3:194786158-194786180 TCTCCTCACCAGAGAGCAGAGGG + Intergenic
967973209 3:195014422-195014444 GCTCCTAACTGGAAGTCAGAAGG + Intergenic
968139109 3:196242060-196242082 GCTCCAACACAGAGGACAGAAGG - Exonic
969494159 4:7516371-7516393 GCCCCTAACAACAGGCCAGATGG - Intronic
976348097 4:84028499-84028521 GCTACTAACCAGACAGCAGAAGG + Intergenic
981788765 4:148511309-148511331 GCTCCTACCCAGAAGTCTGAAGG + Intergenic
984499226 4:180537171-180537193 GCTTCTAACCAGAGAGAAGTTGG + Intergenic
985763897 5:1766557-1766579 GCTCCCACCTAGAGGGCAGGTGG + Intergenic
987171526 5:15264014-15264036 GCACCTAACCACAGAGCAAAGGG + Intergenic
988602547 5:32653428-32653450 GTTGGTAAGCAGAGGGCAGAGGG + Intergenic
989256646 5:39373094-39373116 TCTCCCAACCAGAGGGTAGAAGG + Exonic
991512502 5:67395256-67395278 GCTCCCACCCTGAGTGCAGAGGG - Intergenic
992493896 5:77272560-77272582 GCTCCAAACCAGACTGCAGCTGG - Intronic
996551688 5:124737117-124737139 TATGCTAACCAGAGAGCAGATGG - Intronic
997392490 5:133528430-133528452 GCATCTAACCAGAGAACAGAAGG - Intronic
998450604 5:142231736-142231758 GAACCTAACTAGAGGGCAGAAGG - Intergenic
1000181750 5:158818170-158818192 GGTCCTAACAAGAGGATAGAAGG - Intronic
1001152657 5:169245703-169245725 GCACCTAAGCAAATGGCAGATGG + Intronic
1001724640 5:173887027-173887049 GCTCCAAACCAAATGGCAAAAGG + Intergenic
1003019164 6:2495436-2495458 GCAGCCAACCAGAGGGCAGCAGG - Intergenic
1003626691 6:7747579-7747601 GCTCCTATCTGGAGGGAAGAGGG - Intronic
1004019386 6:11762851-11762873 GATCCTAACCCGAGGGGAGCTGG - Intronic
1004485044 6:16058585-16058607 GATCCTGAGCAGAGGGCAGGAGG - Intergenic
1010110031 6:72216392-72216414 GCTCATCTCCAGAGGGCAAAAGG - Intronic
1011748497 6:90432215-90432237 GCACCCAACCTGAGGGGAGAAGG - Intergenic
1014180976 6:118383989-118384011 GGGACTAACCAGAGGTCAGAAGG - Intergenic
1014559867 6:122876605-122876627 GCTTCTCATCAGAGGACAGATGG + Intergenic
1016416498 6:143839788-143839810 GCTCGTACCCAGGAGGCAGAGGG - Intronic
1018651265 6:165992996-165993018 GCTCCTCACCACATGGCAGAAGG - Intergenic
1020343091 7:7133817-7133839 GGTTCTCACCAGAGGGCAGGGGG + Intergenic
1026927571 7:74204574-74204596 GCTCTTAACCAAAGGGAAAAGGG + Intronic
1028394715 7:90355748-90355770 GATCCTAAGCAGAGGCAAGAAGG - Intronic
1028502460 7:91534182-91534204 GCTCCTTAACTGAGGGAAGAAGG - Intergenic
1029035237 7:97513064-97513086 GCCCCTGACAAGGGGGCAGAAGG + Intergenic
1033164548 7:139028501-139028523 GATCCTAACCAAAGGAGAGAAGG - Intronic
1034401382 7:150863921-150863943 ACCCCTAACAAGATGGCAGAAGG + Intergenic
1034711011 7:153191535-153191557 TCATCTACCCAGAGGGCAGAGGG - Intergenic
1040432851 8:47361306-47361328 CCTCCTAACCAATGGTCAGATGG - Intronic
1041554886 8:59142202-59142224 GTTCCTAACCAGCCGACAGAAGG - Intergenic
1042152940 8:65809094-65809116 GCTCCTTGCCAGAGGTCACATGG - Intronic
1046920143 8:119719158-119719180 GCTCCCAAAGAAAGGGCAGAAGG - Intergenic
1047279336 8:123431627-123431649 GCTCCTAACCCTAGAGCTGAGGG - Intronic
1049497699 8:142944176-142944198 GCTGGAAAACAGAGGGCAGAGGG + Intergenic
1051550141 9:18318587-18318609 GTTCCTGACCAGAGGAGAGAAGG + Intergenic
1056366524 9:85910417-85910439 GCTTGAACCCAGAGGGCAGAGGG + Intergenic
1057265632 9:93615786-93615808 TCTCCAAACCAGTGGGCAGATGG - Intronic
1058892856 9:109375553-109375575 GCTCCTGACCAGAGGGAAGGTGG + Intronic
1059240032 9:112796560-112796582 GCTTCTGACTACAGGGCAGATGG - Intronic
1060564945 9:124582404-124582426 GGGGCTTACCAGAGGGCAGAGGG + Intronic
1060570215 9:124631820-124631842 GGGGCTTACCAGAGGGCAGAGGG - Intronic
1061054503 9:128215244-128215266 GCTCCTCAGCATGGGGCAGATGG + Intronic
1190457900 X:50643417-50643439 GGTCTTAACTGGAGGGCAGATGG - Intronic
1194130721 X:90078633-90078655 GGTCCAAAGCAGTGGGCAGACGG - Intergenic
1198991883 X:142523995-142524017 GAACCTAACCAGAAGTCAGATGG + Intergenic
1199622893 X:149715025-149715047 GCTCCTTACCCGAGGACACATGG + Intronic
1200218824 X:154380642-154380664 GCCTCTAACCAAAGGTCAGAGGG + Intronic