ID: 958717238

View in Genome Browser
Species Human (GRCh38)
Location 3:97799925-97799947
Sequence TCTTACTTGGGACAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958717234_958717238 8 Left 958717234 3:97799894-97799916 CCAGAATAACAATTAAAATGATA 0: 1
1: 0
2: 3
3: 60
4: 613
Right 958717238 3:97799925-97799947 TCTTACTTGGGACAGCAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958717238 Original CRISPR TCTTACTTGGGACAGCAACC AGG Intronic
902514422 1:16982319-16982341 TCTTACTGAGGACTGCACCCTGG - Intergenic
905433423 1:37940920-37940942 ACTTACTTGGGACAGCTGCTGGG + Intronic
910451270 1:87348294-87348316 TCATAGGTGGGACAGCACCCAGG - Exonic
913196961 1:116465183-116465205 TCTTAGTTGGGGCATCACCCAGG + Intergenic
915625302 1:157110797-157110819 TCTGTCTGGGGACAGGAACCTGG + Intergenic
917675200 1:177312110-177312132 TCTTCAGTGGGACAGCAATCGGG + Intergenic
919312931 1:195934155-195934177 TCTTACTTGGAACATCCACAAGG + Intergenic
921333496 1:214063875-214063897 TCTTAATTGTCACAGCAACCTGG - Intergenic
922867162 1:228869730-228869752 TCTTCCTGGGCACAGAAACCTGG - Intergenic
1070404216 10:76080296-76080318 TCTCACTTGGGAAAGCAAGATGG - Intronic
1070835852 10:79446443-79446465 TCTTTCCTGGGGCAGGAACCCGG - Intergenic
1073859789 10:107724894-107724916 GCTTACCTGGGATAGAAACCAGG - Intergenic
1074516835 10:114178272-114178294 TCTTACTGAGGACTGCAACCAGG + Intergenic
1078383602 11:10866874-10866896 TCTTACTGAGCACTGCAACCCGG + Intergenic
1078422994 11:11227679-11227701 TCTTCCTTGGCACAGCAATATGG + Intergenic
1080824749 11:35838301-35838323 GCTGAATTGGGCCAGCAACCGGG + Intergenic
1083591738 11:63899437-63899459 TCTTCCCTGGGTCAGCTACCAGG - Intronic
1083648857 11:64188758-64188780 TTTGACTTAGGACAGCAAACTGG + Intronic
1084404205 11:68961524-68961546 TCCAACTGGGGACAGCAATCCGG - Intergenic
1085119119 11:73955971-73955993 TCTTACTGCGGACAGGAAGCTGG - Intronic
1087919421 11:103849218-103849240 TCTCACTTGAGACAGCAAAAAGG - Intergenic
1089438468 11:118493140-118493162 TCTTACTGAGGTCAGCAAACAGG + Exonic
1090898424 11:131002375-131002397 TCAGCCTTGGGACAGCAATCGGG - Intergenic
1092978965 12:13774432-13774454 TCATCCCTGGGACAGCAACTAGG + Intronic
1099373944 12:81872770-81872792 TCTCATTTTTGACAGCAACCTGG - Intergenic
1103015008 12:117487469-117487491 CCCTGCCTGGGACAGCAACCTGG - Intronic
1104405202 12:128511159-128511181 TCCTACTTGGGACTGCAGCGTGG - Intronic
1108312725 13:49211785-49211807 TCTTTCCTGGGACAGGAGCCTGG - Intergenic
1108381487 13:49859081-49859103 TCTCACAAGGGACAGAAACCAGG - Intergenic
1112101356 13:96193107-96193129 TCTCTCTTTGGACAGAAACCTGG - Intronic
1118561515 14:67088839-67088861 TGTTTCTTGGGACAGAAATCAGG + Intronic
1124166048 15:27326883-27326905 TCTTACTCTGAACAGCAACATGG + Exonic
1124819352 15:33028979-33029001 TCTTACTTGTCACAGAAACCAGG - Intronic
1126896795 15:53266420-53266442 TCTCACTAGGGAGAGCACCCCGG + Intergenic
1126931723 15:53660802-53660824 TCTAACCTGTGACAGAAACCGGG - Intronic
1127558951 15:60116521-60116543 ACCTACTTGTGACAGCAGCCTGG + Intergenic
1128952266 15:71898119-71898141 TCTTACTTTGGATATCAACAGGG - Exonic
1139738355 16:69013218-69013240 TTTTAATTGAGACAACAACCTGG - Intronic
1144268057 17:13590752-13590774 TAGTACTTGGGATAACAACCAGG + Intronic
1150713387 17:67550408-67550430 TCTTATTTCTGACAGTAACCAGG - Intronic
1156381561 18:36566538-36566560 TCTTGCTTGGGACAGGGCCCAGG - Intronic
1156580444 18:38368888-38368910 CTTTTCTTGGGACAGCAAGCTGG - Intergenic
1158111728 18:53947531-53947553 TCTGACTTGGGACTGGGACCTGG - Intergenic
1165377298 19:35451708-35451730 TCATACAGGGGAAAGCAACCTGG + Exonic
929311353 2:40429651-40429673 TCTTCTTTGTGACAGCAGCCTGG - Exonic
933420939 2:82044026-82044048 TGTTGCATGGGACAGCCACCTGG - Intergenic
940025498 2:149202779-149202801 TCTTACTTGTGATACCAAACTGG + Intronic
941199168 2:162488177-162488199 TCTTAGTTGCCAAAGCAACCAGG + Intronic
941492146 2:166155509-166155531 TCTCACTTGGGAAACCAACTTGG - Intergenic
942608962 2:177721947-177721969 ACTTTCTTGGGACTGAAACCTGG - Intronic
944135710 2:196397248-196397270 CCTTAGTTGGGACAGAAAGCAGG - Intronic
944175872 2:196828883-196828905 CCTCAGATGGGACAGCAACCTGG + Intergenic
945946224 2:215998341-215998363 TAATAATTGGGACAACAACCAGG + Intronic
1172550193 20:35793103-35793125 GCTTTCTTGGGACAGCAGCATGG + Intronic
1173542597 20:43865759-43865781 TCTTACCTGGGAGAGCAATTTGG - Intergenic
1174654239 20:52157036-52157058 TCTTACTTGGGAAAGCTGGCTGG - Intronic
1181151578 22:20887384-20887406 TTTTACTAGGAACAGCAGCCAGG - Intronic
1182994908 22:34803130-34803152 TCTAACCTGGGTCAGGAACCAGG + Intergenic
1183077525 22:35436377-35436399 TGTTACATGTGACAGCATCCAGG + Intergenic
1183539187 22:38419731-38419753 TCAGGCTTGGGACAGCAGCCAGG - Intergenic
949786491 3:7747193-7747215 TCTTACTTGAGCCAGCAAGGAGG - Intergenic
953404958 3:42655442-42655464 TCTGACTTGGGTGAGCAGCCTGG + Intronic
958717238 3:97799925-97799947 TCTTACTTGGGACAGCAACCAGG + Intronic
961486443 3:127220599-127220621 TTTTATTTGGGACAGCCAGCAGG - Intergenic
964679699 3:159324026-159324048 TGTTACTAGAGATAGCAACCTGG + Intronic
969108323 4:4825144-4825166 TCTTATGTGGGAAAGCAAGCAGG + Intergenic
970431684 4:15994774-15994796 TCTTCCTTGCCACAGCAGCCAGG + Intronic
972669756 4:41204011-41204033 TCTTGCTTGGCACAGCAAGTGGG - Intronic
975538607 4:75478834-75478856 TGTCACTTGTGACAGGAACCTGG + Intergenic
981502596 4:145468230-145468252 TCATACTTAGGAGAGCAAGCAGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1004302403 6:14470335-14470357 TGTTACTAGAGACAGCAATCTGG - Intergenic
1006098438 6:31670788-31670810 TCCTACTTGGGGCAGGATCCTGG - Exonic
1009055841 6:58334112-58334134 TCTTACTTGAGACAATAACTGGG - Intergenic
1009235335 6:61116489-61116511 TCTTACTTGAGACAATAACTGGG + Intergenic
1014205949 6:118655492-118655514 ACTTGTTTGGGACAGCAACCTGG + Intronic
1017405642 6:154115727-154115749 TCTGCCCTGGGGCAGCAACCTGG + Intronic
1017708451 6:157146106-157146128 ACTGACTTGGGACAGCCACTGGG - Intronic
1018776665 6:167023502-167023524 TCTAACTTAGCACAGCAACAGGG - Intronic
1021514706 7:21471535-21471557 TCTTAATTGGGACAGTAAGCTGG + Intronic
1023518919 7:41031401-41031423 TCTTACTTGGCAAAGCAACTGGG - Intergenic
1026280082 7:68914520-68914542 TTTCACTTAGGACATCAACCAGG + Intergenic
1029513050 7:101008788-101008810 TCTCACGTGGGACATCACCCTGG - Intronic
1029724678 7:102394719-102394741 TCTTACTGAGGACTGTAACCAGG + Intronic
1032586363 7:133150839-133150861 TCTTCCTGGGAACAGCATCCTGG + Intergenic
1033878609 7:145854491-145854513 TCTTACTTGGGCCATTTACCAGG + Intergenic
1037390959 8:18391329-18391351 ACTTACTTTGGCCAGCAACCAGG - Exonic
1040004473 8:42607937-42607959 ACTTCATTGGGATAGCAACCGGG + Intergenic
1041293165 8:56326940-56326962 TCTTACTGAGGATTGCAACCTGG + Intergenic
1045876821 8:106991433-106991455 TCTTGGTTTGGACAGCAACTGGG + Intergenic
1049006530 8:139859134-139859156 TCTGACTCGGGCCAGAAACCGGG - Intronic
1050340495 9:4632897-4632919 ACTTACTTGTGAAAGCAACATGG + Intronic
1050477267 9:6053115-6053137 TGTGACTTGGGACAGCAAGGGGG + Intergenic
1050719278 9:8566901-8566923 TTTTACTTGGAGCAGCAACCAGG - Intronic
1055966299 9:81868316-81868338 TCTTACTTGGGGCTGCCAGCTGG - Intergenic
1060777858 9:126389743-126389765 CCACACTTGGGACAGCAACCTGG - Intronic
1189228358 X:39432499-39432521 TCTCACTTGAGACAGGAGCCAGG + Intergenic
1191678269 X:63814764-63814786 GCTTACTTGGGACCCCAACGTGG - Intergenic
1196067600 X:111482099-111482121 TGTTGCTTGGCAAAGCAACCTGG + Intergenic