ID: 958718800

View in Genome Browser
Species Human (GRCh38)
Location 3:97820940-97820962
Sequence AGGGCTTCTGGGAGGCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958718791_958718800 30 Left 958718791 3:97820887-97820909 CCAGAACAAATGAGAATGAGTGT 0: 1
1: 0
2: 1
3: 23
4: 233
Right 958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG 0: 1
1: 1
2: 3
3: 50
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958718800 Original CRISPR AGGGCTTCTGGGAGGCAGCG TGG Intergenic
900014163 1:137360-137382 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900044026 1:492562-492584 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900065436 1:727468-727490 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900250097 1:1664432-1664454 AGGGCTTGTCAGAGGCAGCATGG - Exonic
900261128 1:1730338-1730360 AGGGCTTGTCAGAGGCAGCATGG - Intronic
900539473 1:3195723-3195745 AGGGCTTCTGCGTGGGGGCGTGG + Intronic
900596363 1:3481893-3481915 AGGGCTTAGGGGAGGAGGCGAGG + Intergenic
900623040 1:3596146-3596168 AGGGCTTCCCGGAGGCAGTGTGG + Intronic
900780885 1:4616517-4616539 AGGGCACCTGGTAGGCAGGGAGG + Intergenic
901451971 1:9341291-9341313 AGGGCATGAGGGAGGCAGTGGGG + Intronic
901637555 1:10677342-10677364 AGGGTGTCTGGGTGGCACCGAGG + Intronic
901941172 1:12663071-12663093 AGGGCTTCCAGGAGGCTGCAGGG + Intronic
902288728 1:15423141-15423163 AGGGGTTCTGGGGGGCACAGCGG - Intronic
902631089 1:17705134-17705156 AAGGCTTCCTGGAGGCAGGGAGG + Intergenic
902643092 1:17779221-17779243 AGGGGTTGTGGGAGGGAGAGGGG - Intronic
903738465 1:25544564-25544586 GGGGCGTCTGGGAGGCTGGGAGG + Intronic
904385634 1:30140354-30140376 AGGGGTGCTGGGAGGAAGCTGGG + Intergenic
904762227 1:32813842-32813864 AATGCTTCTGGGAGGGAGTGAGG - Intronic
904770969 1:32881251-32881273 AGAGCCTCTGGTAGGCAGCAGGG + Intergenic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
905010134 1:34741698-34741720 AGGATCCCTGGGAGGCAGCGAGG + Intronic
905357314 1:37393837-37393859 AGAGCTGTTGGGAGCCAGCGAGG + Intergenic
906212492 1:44019889-44019911 AGGGCTGCAGGGAGGCTGTGTGG + Intronic
906275298 1:44510793-44510815 AGTGCTTCTGGGAGGCACTAAGG + Intronic
906593162 1:47047266-47047288 AGGGCTTATAGGAAGCAGAGGGG + Intronic
907160926 1:52368485-52368507 ACCGCCTCGGGGAGGCAGCGCGG - Intergenic
907239960 1:53075874-53075896 AGGGCGTTTGGCAGGAAGCGGGG - Exonic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907661827 1:56400281-56400303 AGTGCTTGTGGGAGGCATAGTGG + Intergenic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
910170200 1:84369009-84369031 AAGGCTTCTGGGAGCCACCAAGG - Intronic
912456771 1:109803350-109803372 ATAGCTTATGGGAGGCAGAGAGG + Intergenic
912637005 1:111305465-111305487 AGAGCTTGTGGGAGCCAGGGTGG - Intronic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
913121035 1:115740906-115740928 AGGGTTTCTGGGTGACAGTGGGG + Intronic
914827055 1:151144229-151144251 AGGGCAACTTGGAGGCAGGGGGG - Intronic
915509967 1:156381525-156381547 AGGACTTCAGAGAGGCAGAGGGG + Intronic
916213942 1:162380331-162380353 AGGGCCTTTGGGTGGCAGGGAGG - Intronic
916470278 1:165117056-165117078 ACGGTTTCTTGGAGGCAGTGAGG + Intergenic
916571796 1:166034409-166034431 AGGGCTGCAGGGAGGAAGCCTGG + Intergenic
917511919 1:175675837-175675859 GGGGCTTCTGGGAGGACGCTGGG + Intronic
917765955 1:178217352-178217374 AGGGCTTTGGGGAGGAAGCAGGG - Intronic
917981095 1:180269899-180269921 AGGGCTTCAGGGAGGGAGTTGGG + Intronic
919915104 1:202134198-202134220 AGGGCTGCTGGGAGGGAGGCAGG + Exonic
919929612 1:202212935-202212957 AGGGCTTCCTGGAGGAAGCTTGG - Intronic
920257783 1:204667849-204667871 TGGGCATCTGGGAGGCAGTGAGG + Intronic
920455379 1:206097234-206097256 AGGGCTGCAGGGAGGCAGGAGGG - Intronic
921093726 1:211868620-211868642 TGGGCTTCTGGTAGGGAGGGGGG - Intergenic
922057296 1:222053277-222053299 AGGGCTGCTGGGAAGCCCCGTGG - Intergenic
922500581 1:226094433-226094455 AGGGCTCCTGAGAGGCAGCTTGG + Intergenic
922734494 1:227971965-227971987 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922734715 1:227972854-227972876 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
922734775 1:227973096-227973118 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922775788 1:228213744-228213766 GCGGCTTCGGGGAGGTAGCGGGG + Intronic
923030500 1:230245843-230245865 TGGCCTGCTGGGAGGCAGGGAGG - Intronic
924226091 1:241922815-241922837 AGGACTTCGGGGAGGGAGCTGGG + Intergenic
924343490 1:243054935-243054957 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924592453 1:245416639-245416661 AAGGCTTCTCGGAGGAAGTGAGG + Intronic
924946485 1:248850263-248850285 TGGGCCTCTGGGATCCAGCGAGG - Exonic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1062882132 10:987885-987907 AGGGCTGCAGGGAAGCCGCGAGG + Intergenic
1063339798 10:5252495-5252517 AGGGCCTGAGGGAGGCAGCCAGG - Intergenic
1063343933 10:5294156-5294178 AGGGCCTGAGGGAGGCAGCCAGG + Intergenic
1066474614 10:35733301-35733323 AGGGCTTGTGGGAGGAAGAATGG - Intergenic
1066732626 10:38449169-38449191 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1066733032 10:38450775-38450797 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1067827719 10:49591490-49591512 TGGGCTGCTGCGAGGCAGTGAGG + Intergenic
1068547121 10:58360167-58360189 AGTGATACTGGGAGGCAGAGTGG - Intronic
1069247140 10:66220410-66220432 AGTGCTTCTGGGCGCCAGCAGGG + Intronic
1069425238 10:68282606-68282628 AGGTCTTCTGGGGGGCGGTGGGG + Intergenic
1069609381 10:69762521-69762543 AGGGCTTCTTGGAGGTGGCAAGG - Intergenic
1069893302 10:71665325-71665347 AGGGGTAGTGGGAGGCAGTGGGG - Intronic
1069931969 10:71889080-71889102 AGGTCTGCTGGGACGCAGCGCGG + Intergenic
1070347309 10:75557468-75557490 TGGGATTTTGGGAGGCAGCCTGG + Intronic
1070396102 10:76012286-76012308 TGGGCTTCTGAGATGCACCGTGG - Intronic
1070969275 10:80550057-80550079 AGGGCTTTTGGTGGGGAGCGGGG + Intronic
1070971293 10:80569582-80569604 TGGACATCTGGGTGGCAGCGAGG + Intronic
1071450273 10:85787007-85787029 ATGGCAGCTGGGAGGCAGAGGGG - Intronic
1072555530 10:96511791-96511813 GGGGACTCTGGGAGGCAGTGTGG - Intronic
1073042577 10:100617616-100617638 AGGGCTGCTGGGAGGGAGGAAGG - Intergenic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073452954 10:103620223-103620245 CGGGCTTCTGGGAAGCACTGGGG + Intronic
1073899505 10:108203819-108203841 ATTGCTTCAGTGAGGCAGCGGGG + Intergenic
1075413989 10:122249183-122249205 AGGGCTGCTGGGAGGCCCCTGGG - Intronic
1075706464 10:124504893-124504915 AGTGCGTCTGGGAGGGAGCGGGG + Intronic
1076171319 10:128322518-128322540 AGGGCTGGTTGGAGGCAGAGTGG - Intergenic
1076510508 10:131011092-131011114 AGGCCTCCTGGGAGGCAGGCAGG + Intergenic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076757271 10:132579127-132579149 TGGGCTTCTGAGTGGCAGGGAGG + Intronic
1076855990 10:133115875-133115897 AGGGTCTCTGGAAGGCAGGGAGG - Intronic
1076876011 10:133215843-133215865 AGGGCTGCTGGCACCCAGCGTGG + Intronic
1076970363 11:129037-129059 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1077052673 11:574827-574849 GGGGCTTCTGGAAGCCAGAGAGG - Intergenic
1077375998 11:2205378-2205400 TGGGCTGCTGGGAGGTAGGGAGG - Intergenic
1077376724 11:2208752-2208774 AGGGCTGCTCACAGGCAGCGGGG - Intergenic
1077431967 11:2520215-2520237 GGGGCTTCTGGGGGGCAGCCTGG + Intronic
1077462606 11:2718162-2718184 AGGGCCTCTGGGCTGCAGTGGGG - Intronic
1078288560 11:9983227-9983249 AGGGCTACTGGGGGGCACAGCGG + Intronic
1078316994 11:10302748-10302770 AGGGCAGCGAGGAGGCAGCGAGG + Intergenic
1078719465 11:13871250-13871272 TGGGGTTCTAGGAGGCAGGGTGG - Intergenic
1078749317 11:14144841-14144863 AAGGCTTCTGGGAGTCAGATTGG + Intronic
1079110471 11:17602403-17602425 AGCTCTTCTGGGAGGCAGGAGGG + Intronic
1079121229 11:17686502-17686524 AGGGCCTCTGGGAAGCAGGCAGG - Intergenic
1081135201 11:39431920-39431942 AGGGCCTGTTGGAGGCTGCGGGG + Intergenic
1081807520 11:45898677-45898699 AGAGGGTCTGGGAGGCCGCGTGG - Intronic
1081857275 11:46311891-46311913 AGCGCTCCTTGGAGGCAGCCTGG - Intronic
1081963075 11:47152508-47152530 AAGGCTTCCGCGAGGCTGCGAGG + Intronic
1082261283 11:50077718-50077740 AAGGCTGCTGGGAGGCAGGTAGG + Intergenic
1083812221 11:65112343-65112365 AAGGGAACTGGGAGGCAGCGGGG + Intronic
1084333967 11:68446312-68446334 AGGGGTCCTGGGAAGCAGGGGGG + Intronic
1084438014 11:69155411-69155433 TGGGCCTCTGGGAGTCAGCAAGG - Intergenic
1084656640 11:70523543-70523565 AGGGCTTCGGGGCAGCACCGGGG - Intronic
1085109803 11:73877324-73877346 AGGGATACTGGGAGGCAGGAAGG + Intronic
1085252370 11:75152337-75152359 TGGGCTTCTGGGAGCAAGTGGGG - Intronic
1085299738 11:75450975-75450997 ACGGCTCCAGGGAGGCAGGGCGG - Intronic
1085641929 11:78198112-78198134 GGGGCTTCTGAGAGGAAGAGAGG - Intronic
1085765270 11:79276779-79276801 AAGGCTGCTGGGAGGGAGAGGGG - Intronic
1088988309 11:114929157-114929179 AGGGATTTGGGGAGGCAGCAGGG + Intergenic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089535837 11:119160425-119160447 AGGTCTTGTGGGAGGAAGCAGGG + Intronic
1090206036 11:124884976-124884998 AGGGCCTCTGGGAAGAAGCCAGG - Intronic
1090217686 11:124984332-124984354 TGGGCCTCTGGGAGGCACCCCGG + Intronic
1090624464 11:128593836-128593858 AGGGCTTCTGGGAGGTGTCTGGG + Intergenic
1090848414 11:130549288-130549310 AGGGCTTCTAGGAGGCAGGAAGG + Intergenic
1091251787 11:134150331-134150353 AGGGCTTCTGGGTGGCCTCTGGG - Exonic
1092146271 12:6216783-6216805 AAGGCGGCTGGGTGGCAGCGGGG - Intronic
1092999176 12:13979704-13979726 TGGGCTTTTGGGGGGCAGTGGGG - Intronic
1093211502 12:16314350-16314372 AGGGCTTCTGGGAGGTTACTAGG - Intergenic
1093754068 12:22832936-22832958 AGGGCTTTTGGGAGGTGACGAGG + Intergenic
1095259468 12:40082114-40082136 AGGGCTTCGGCAAGGCAGCAGGG + Intronic
1096452489 12:51756063-51756085 AGGCCTACTGTGAGGCATCGGGG - Intronic
1096615438 12:52830353-52830375 AGGGCTTCTGTAAGGCTGAGTGG - Intronic
1097033589 12:56106939-56106961 AGGGCTCCCGGGAGACAGCAAGG + Intronic
1098386904 12:69929287-69929309 AGGGCATGTGGGAGGCAGAAAGG + Intronic
1098882768 12:75933413-75933435 AGAGCTTCTGGGAGGCCAAGGGG - Intergenic
1101842664 12:108339458-108339480 TGGGCTTGTGGGTGGCGGCGGGG + Intergenic
1102009154 12:109607409-109607431 TGGGCTTCTGGAAGGCAGGCTGG - Intergenic
1103196067 12:119044682-119044704 AGGGCTGCTGGGAGGAACCAGGG + Intronic
1103557620 12:121775772-121775794 AGGGCTGCTGGGAAGGAGCCCGG - Exonic
1103832309 12:123789630-123789652 AGTGCTTCAGGGAGGCTGAGGGG - Intronic
1104079055 12:125414547-125414569 CAGGCTTCTGGGAAGCAGAGAGG + Intronic
1104595048 12:130115248-130115270 GGGGCTTGCGGGAGGCGGCGTGG - Intergenic
1104761204 12:131298587-131298609 GGGGCATCTGGGGGGCGGCGGGG + Intergenic
1104818571 12:131662205-131662227 GGGGCATCTGGGGGGCGGCGGGG - Intergenic
1104941182 12:132396119-132396141 CGGGCTTCTGACAGGCTGCGGGG - Intergenic
1105472597 13:20705832-20705854 AGGGCTTCACTCAGGCAGCGCGG + Intronic
1106488848 13:30197392-30197414 AGGGCTTCTGGGAGACAGAAGGG + Intergenic
1110043139 13:70791739-70791761 GGTGCTTTTGGGAGGAAGCGAGG - Intergenic
1111854616 13:93622008-93622030 AGGGTGTCTGGGTGGCAGCTGGG - Intronic
1112438895 13:99410970-99410992 AGAGTTTCTGGGAGGCTGTGAGG - Intergenic
1113775738 13:112943839-112943861 AGGGGATCTCGGTGGCAGCGGGG + Intronic
1113850142 13:113413292-113413314 AGCTCGTCAGGGAGGCAGCGAGG - Intergenic
1113941203 13:114019414-114019436 AGGGCTCCTGGGTGACTGCGTGG - Intronic
1114042212 14:18689422-18689444 AGGGAGTGTGGGAGGGAGCGAGG + Intergenic
1114267573 14:21081840-21081862 AGGGCTGCTGGGGAGCAGCAAGG - Exonic
1116385941 14:44330001-44330023 TGGGCTGCTGGGTGGCAGCAAGG + Intergenic
1117986006 14:61386740-61386762 AGTGCTGGTGGGAGGCAGGGAGG + Intronic
1118974514 14:70665221-70665243 AGGACTTCAGGCAGGGAGCGTGG + Intronic
1119380848 14:74227341-74227363 GGGGCATCTGGGAGTCATCGAGG + Intergenic
1119825096 14:77651151-77651173 CAGGGTACTGGGAGGCAGCGGGG - Intergenic
1120885064 14:89445579-89445601 AGGGCTTCAGCAAGGCAGCCTGG + Intronic
1121690958 14:95876842-95876864 AGGACCTCGGAGAGGCAGCGCGG - Intergenic
1122047404 14:99034044-99034066 AGGGCTCCTGGCAGCCAGCTGGG - Intergenic
1122093185 14:99353300-99353322 CTGACTTCTGGGAGGCAGCCAGG + Intergenic
1122233740 14:100320532-100320554 TGGGCTTCAGGCAGGCAGGGTGG - Intergenic
1122353637 14:101111310-101111332 AGGGCTTCTGGGCCTCAGCCTGG + Intergenic
1122784467 14:104157476-104157498 AGGACTCCTTGGAGGCAGAGAGG - Intronic
1122890094 14:104728211-104728233 AGACCTTCTGGGAGTCAGAGGGG + Intronic
1123427476 15:20184065-20184087 TGGGCTTCAGGGAGGCAGGCAGG - Intergenic
1123536712 15:21190615-21190637 TGGGCTTCAGGGAGGCAGGCAGG - Intergenic
1125592599 15:40864185-40864207 AGGTCTGCTGGGAGCCAGGGAGG + Intergenic
1125719644 15:41839188-41839210 AGGGCCTCAGGGCGGCAGCTGGG - Intronic
1126401360 15:48274159-48274181 AGTCCTTCTGGGAGGCGGCCAGG + Intronic
1128508668 15:68299808-68299830 AGAGCTTCTAGGAGACAGTGTGG - Intronic
1128536352 15:68493568-68493590 AGTGCTTCTGGAAGGCAAGGTGG + Intergenic
1129391032 15:75221027-75221049 ATGGCATCTGGGTGGCAGCATGG + Intergenic
1129472332 15:75762650-75762672 AGGGTTGGTGGGAGGCAGCTGGG - Intergenic
1129473277 15:75766850-75766872 ATGGCATCTGGGTGGCAGCATGG - Intergenic
1129491867 15:75935128-75935150 AGGGCCTCTGAGAGGCAGGGAGG - Exonic
1130014176 15:80174625-80174647 AGGGCCCCTGGAAGGCAGAGGGG - Intronic
1130051135 15:80484828-80484850 AGGGGTGTAGGGAGGCAGCGGGG + Intronic
1130460110 15:84154157-84154179 AGGGGTTCTGAGAGGGAGGGAGG + Intergenic
1131377457 15:91937374-91937396 AGGGTCTCTGGGAGGCAGCCAGG + Intronic
1131505156 15:93011333-93011355 AGGTCTTCTGAGAGGCAGGCAGG + Intronic
1131659981 15:94503928-94503950 AGGGCCTTTGGGAGGCAGTTAGG - Intergenic
1131745298 15:95440950-95440972 AAGACATCTGGGAGGCAGCCAGG + Intergenic
1132204601 15:99977805-99977827 AGGGCTCCTGGGAGAAAGCAGGG - Intronic
1132314313 15:100879465-100879487 CCGACTTCGGGGAGGCAGCGGGG + Exonic
1132466916 16:81761-81783 AGGGCTTCCCGGAGGTAGGGTGG - Intronic
1132466968 16:81932-81954 AGGGCTTCCTGGAGGTAGGGTGG - Intronic
1132467023 16:82103-82125 AGGGCTTCCCGGAGGTAGGGTGG - Intronic
1132549526 16:548580-548602 AGGGCTTCCCAGGGGCAGCGTGG + Intronic
1132806342 16:1776853-1776875 AGGTCTTGTGGGAGGCTGCGAGG - Exonic
1132808661 16:1787421-1787443 GGGGCCTCGGGGAGTCAGCGGGG + Intronic
1132826902 16:1909669-1909691 AGGGCCTGTGGGACTCAGCGGGG + Intergenic
1132886959 16:2186589-2186611 TGGGTTTCTGGGTGCCAGCGTGG - Intronic
1133058290 16:3158400-3158422 TGGCCTGCTGGGAGGCGGCGGGG + Intergenic
1133772200 16:8873625-8873647 AGCACTTTTGGGAGGCAGAGAGG - Intergenic
1134135682 16:11674958-11674980 AAAGCTTCGGGGAGGCAGGGAGG - Intronic
1134172118 16:11976902-11976924 AGGGGGTCTGCGAGGGAGCGGGG - Intronic
1136059661 16:27717900-27717922 AGGGAATCTGGGAGCCAGGGTGG - Intronic
1136637843 16:31537306-31537328 AGGGCGGCCGGGAGGCATCGAGG - Intergenic
1136683607 16:31981749-31981771 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136784236 16:32925309-32925331 GCGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136885548 16:33928497-33928519 GCGGCTCCTGGTAGGCAGCGTGG - Intergenic
1137288794 16:47037781-47037803 AGGGCGCCGGGGAGGCCGCGAGG + Intergenic
1137667345 16:50259436-50259458 AGGGCTTTTGGTTGGCAGGGCGG + Intronic
1137924009 16:52522435-52522457 AGAGCTACTGGCAGGCAGAGTGG + Intronic
1138370734 16:56524525-56524547 AGGCCTGGAGGGAGGCAGCGTGG + Intergenic
1138667053 16:58579720-58579742 AGGGCTACAGGGAGAGAGCGCGG - Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1139361278 16:66401726-66401748 AGGGTTGCCGGGAGGCAGCGTGG + Intronic
1139852643 16:69960299-69960321 GAGGCCTCTGGGGGGCAGCGTGG + Intronic
1139881614 16:70183207-70183229 GAGGCCTCTGGGGGGCAGCGTGG + Intronic
1140370894 16:74412298-74412320 GAGGCCTCTGGGGGGCAGCGTGG - Intronic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141622083 16:85241729-85241751 AGGGCTTCCTGGAGGCGGTGTGG + Intergenic
1141656304 16:85418480-85418502 AGGGCTTCCTGGAGGAGGCGGGG - Intergenic
1141662306 16:85448036-85448058 AGGGCACCTGGCAGCCAGCGAGG + Intergenic
1142156442 16:88534673-88534695 CGGGCTGCGGGGAGGCGGCGGGG - Exonic
1142183951 16:88685740-88685762 AGGGCTTCTGGGGTGAAGGGAGG + Intronic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142288107 16:89179647-89179669 AGGTCTCCTGGGAGCCAGCGGGG + Intronic
1142449888 16:90168445-90168467 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203086893 16_KI270728v1_random:1189315-1189337 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1142457198 17:63401-63423 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1142472698 17:172161-172183 AGGGCGTCTGGGAGGCCTGGAGG + Intronic
1142508676 17:381166-381188 AGGGCTTCTGGGAGGGATGTGGG - Intronic
1142508749 17:381346-381368 AGGGCTTCTGGGAGGGATGTGGG - Intronic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142969627 17:3602551-3602573 ATGACTTCTGGGAGGGAGGGTGG + Intergenic
1143024995 17:3936308-3936330 AGGGCTTCTCGGGGGCTCCGGGG + Exonic
1143102121 17:4510197-4510219 AGGGCTTCCTGCAGGCTGCGAGG - Intronic
1143255311 17:5553389-5553411 AGGGTCTCCAGGAGGCAGCGAGG + Exonic
1143283272 17:5770995-5771017 AGGTCTTCTGGGAAGCAACAGGG - Intergenic
1143513399 17:7407789-7407811 AGGGCTGCTGGGTGGGAGTGGGG + Intronic
1144713739 17:17420268-17420290 AGGGCCTTTGGGAGACTGCGAGG + Intergenic
1145007554 17:19346140-19346162 AGGCTGTCAGGGAGGCAGCGAGG - Intronic
1145031398 17:19507610-19507632 AGGGACTCTGAGAGGGAGCGAGG - Intronic
1145031466 17:19507809-19507831 GGGGATTCTGGGAGGGAGCGAGG - Intronic
1145249498 17:21289505-21289527 AGGGCTGCTGGGCAGCAGCATGG + Intronic
1145254305 17:21314330-21314352 AGGGCATCTGGGAGGAACCGAGG + Exonic
1145322292 17:21773632-21773654 AGGGCATCTGGGAGGAACTGAGG - Intergenic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146655833 17:34634690-34634712 AGAGCTTCTGGGAAGCTGGGAGG + Intronic
1147144525 17:38477456-38477478 GGGGCTCCTGGTAGGCAGCGTGG + Intronic
1147448198 17:40487796-40487818 AGGGCTCCTGGGAGTCATGGGGG - Intronic
1147773211 17:42882099-42882121 AGGGATTCAGGGAGTCAGCTGGG + Intergenic
1148474345 17:47917064-47917086 AGGGCTTCTGGGGTACAGTGGGG - Exonic
1148591438 17:48819233-48819255 AGGGCTTCTAGGAGGGACCTTGG - Intergenic
1148647800 17:49229363-49229385 AGGGCTTCTGGGGGGTTGCAGGG + Intronic
1149478823 17:56985500-56985522 AGGGCCTCTGAGAGGCCACGGGG - Intronic
1151491745 17:74435739-74435761 TGGGCTTCTTGGAGCCAGCAGGG + Intronic
1151553987 17:74837445-74837467 AGGGCTCCAGTGGGGCAGCGAGG - Exonic
1151921996 17:77163939-77163961 TGGGCTCCTGGGTGGCAGCCAGG + Intronic
1152040217 17:77898170-77898192 GGAGCTTCTTGGAGGCAGCCGGG - Intergenic
1152657917 17:81528451-81528473 CGGGCTTCTGGGGGACCGCGGGG + Intronic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1153442237 18:5133125-5133147 CGGGTTCCCGGGAGGCAGCGAGG + Intergenic
1153553368 18:6285065-6285087 ACGGCTTCTGCGGGGCAGCCTGG + Intronic
1154043139 18:10878148-10878170 AGGGCTTCTGTTAGGCAGATTGG - Intronic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1155902372 18:31407218-31407240 AGGGAGTCTGGGAGCCAGCATGG + Intronic
1157332888 18:46716411-46716433 TGGGCTTCTGGGATGGAGTGTGG - Intronic
1157544035 18:48535434-48535456 AAGGCTTCTGGGAGGAAGGTGGG - Intergenic
1157749724 18:50167672-50167694 AGGGCTTCTTGGAGGGAGATGGG - Intronic
1158339165 18:56446919-56446941 AGGGATTCTGGTAGGCTGCCTGG - Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160218162 18:76952475-76952497 TGTGCTTCTGGGAGGAAGCTGGG + Intronic
1160647557 19:200506-200528 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1160694407 19:475605-475627 GAGGCATCTGGGAGGCAGTGAGG - Intergenic
1160735463 19:660360-660382 AGGGCTTCTCCCAGGCAGCTGGG - Intronic
1161348298 19:3778650-3778672 AGGGCTTCCTGGAGGAAGCAGGG - Intronic
1161584647 19:5098664-5098686 GGGGCCTCTGGGAGGCGACGAGG + Intronic
1161857477 19:6773845-6773867 AGGGCTGCTGGGTGGGAACGGGG + Intronic
1162304451 19:9863286-9863308 AGGCCTTGTGGGAAGCAGTGAGG + Intronic
1162963984 19:14147089-14147111 AGGGCTTCTGTGAGACAGCATGG + Intergenic
1163273291 19:16266979-16267001 AGGGATGCTGGAAGGGAGCGAGG + Intergenic
1163311048 19:16514771-16514793 AGGGCTGCAGGGATGCAGTGGGG + Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1164469805 19:28520461-28520483 AGGGTGTCTGGTAGGCAGAGCGG - Intergenic
1164477648 19:28587412-28587434 AGGGCCTTGGGGAGGCAGCAAGG + Intergenic
1166137657 19:40786990-40787012 GGGGCTTTAGGGAGGCAGGGCGG + Intronic
1167129097 19:47572839-47572861 AGGGCCTGTGGGGTGCAGCGGGG + Intergenic
1168354425 19:55692564-55692586 TGGGTTTCTGGGGGGCAGGGGGG + Intronic
1168433037 19:56296224-56296246 AGGGCTTCTCGGAGGAGGAGTGG + Intronic
925910005 2:8567629-8567651 CAGGCTTATGGGAGGCAGCCTGG - Intergenic
927188277 2:20497948-20497970 AGGACTTCTGGGGGGCACCTGGG - Intergenic
927374702 2:22400483-22400505 AGGGCTTCTTGGAGGAGGTGAGG - Intergenic
927485648 2:23486801-23486823 AGGGCTTCAGGGAGGAGGTGTGG - Intronic
927661927 2:25000745-25000767 TGGGCATCTGGGAGGCTGCAGGG + Intergenic
927680910 2:25138403-25138425 AAGGCTACTGGGAGTCAGGGTGG + Intronic
927904292 2:26846559-26846581 TGGGCTTCAGGGAGGTGGCGTGG - Intergenic
930347922 2:50208632-50208654 AGAGCTTCTGGGAAGCAGGGTGG - Intronic
932135767 2:69227317-69227339 GAGGCTTCTGGGAGCCAGCTGGG + Intronic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
933729171 2:85444513-85444535 AGGGCTGGTGGGGGGCATCGGGG - Intergenic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
933909526 2:86927632-86927654 AAGGCTTCTGGGAGACATCATGG + Intronic
934023199 2:87975747-87975769 AAGGCTTCTGGGAGACATCATGG - Intergenic
934946774 2:98548076-98548098 AGGGGGTCAGGGAGGCAGCTAGG + Intronic
935507321 2:103921684-103921706 AGGGCTACTGGGGGGTAGGGAGG - Intergenic
936413355 2:112280658-112280680 AAGGCTTCTGGGAGACATCATGG + Intronic
937122850 2:119452760-119452782 AGGGCAGCAGCGAGGCAGCGGGG - Intronic
938191414 2:129284946-129284968 AGGGCTTAGGGGAGGCAGCAAGG - Intergenic
938278677 2:130049961-130049983 AGTGCTTCTGGGAGGAAAGGAGG + Intergenic
938329652 2:130440820-130440842 AGTGCTTCTGGGAGGAAAGGAGG + Intergenic
938360294 2:130680683-130680705 AGTGCTTCTGGGAGGAAAGGAGG - Intergenic
938436696 2:131287391-131287413 AGTGCTTCTGGGAGGAAAGGAGG - Intronic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
940775178 2:157876636-157876658 GGGGCTCCTCGGAGGCGGCGGGG + Intergenic
941112005 2:161426493-161426515 ACTGCTTCTGGGAGGCATCTGGG + Intronic
941723460 2:168836792-168836814 AGGGCCTCTGGGAGGCAGAATGG - Intronic
942376623 2:175344100-175344122 AGGGCGTGTGGGAGCCAGCATGG + Intergenic
944860347 2:203810262-203810284 AGGCCCTCTGGGAGCCAGTGTGG + Intergenic
945046907 2:205789649-205789671 CCGGCCTCTGGGAGGCAGAGGGG - Intronic
945200530 2:207276958-207276980 AGGGGTTCAGGGAGGCAGGAGGG - Intergenic
946078622 2:217097163-217097185 CAGGCTTCTGGGAGCCTGCGGGG - Intergenic
946148303 2:217747375-217747397 TGGGCCCCTGGGAGGCAGTGGGG + Intronic
946193973 2:218022396-218022418 AAGGATTCAGGGATGCAGCGTGG - Intergenic
946397127 2:219448805-219448827 AGGGCGGCTGGGCGGCGGCGGGG - Exonic
946408073 2:219502724-219502746 AGGGCTTCCTGGAGGAAGCAAGG + Intronic
946669871 2:222091256-222091278 AGGGCTTCAGGGAGGCGGCGAGG - Intergenic
947633169 2:231666531-231666553 AGGCCATCTGGGAGGCAGGCTGG + Intergenic
947949505 2:234135222-234135244 TGAGCATCTGGGAGGCAGCCTGG + Intergenic
948124246 2:235553296-235553318 TGGACATCTGGGAGGCAGTGGGG + Intronic
948763615 2:240208344-240208366 AGGGCTCCTGGCAGGGAGAGAGG + Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948942527 2:241203508-241203530 AGGTGGTCTGGGGGGCAGCGGGG - Intronic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168856647 20:1013569-1013591 GGGGCTGCAGGGAGGCAGTGAGG - Intergenic
1169365271 20:4987068-4987090 AGGGCTGCAGGTGGGCAGCGTGG + Intronic
1170226961 20:14001672-14001694 AGGTCTTCTGGGAGGCCTCAGGG + Intronic
1170950743 20:20933713-20933735 AGGGAAGGTGGGAGGCAGCGAGG + Intergenic
1170967020 20:21082745-21082767 AGGGCTGCTGGTAAGCAGTGAGG + Intergenic
1171846682 20:30281643-30281665 AGCGCTGCGGGGTGGCAGCGAGG - Intergenic
1173590677 20:44222422-44222444 AGGGCTTCTCAGAGGCAGTGTGG - Intergenic
1174203656 20:48824442-48824464 AGGGCTTCCTGGAGGAAGTGAGG - Intronic
1175009639 20:55722103-55722125 AGGAATTCTGTGAGGCAGCCAGG - Intergenic
1175063252 20:56263157-56263179 TGGGCTTGGGGGAGGCAGCAGGG + Intergenic
1175540191 20:59743444-59743466 AGGGCTTCAGGGAGGCCAGGTGG - Intronic
1175715242 20:61251196-61251218 GGGGGTTCTGGGAGGGAGAGAGG + Intergenic
1175824578 20:61930096-61930118 AGGGGCTCTGGGAGGCAGAGTGG - Intronic
1175828758 20:61950945-61950967 AGGGCTGGTGGGAGGGAGGGTGG - Intergenic
1175986536 20:62766701-62766723 CGGTCTTCTGGGAGGGAGAGTGG - Intergenic
1176255645 20:64151327-64151349 GGGGCTCCTGGCAGGGAGCGGGG + Intergenic
1178109228 21:29353963-29353985 AGGGCTTCTGCCAGGGAGGGAGG + Intronic
1179882547 21:44299683-44299705 AGGGCCCCTGGGGGGCAGGGAGG + Intergenic
1180180594 21:46117175-46117197 AGGGCCTCTGGGAGGCAGCCAGG + Intronic
1180834863 22:18924864-18924886 ATGCCTTCTGGGAGGCAGTGGGG + Intronic
1180934845 22:19618690-19618712 CTGGATTCTGGGAGGCAGTGTGG - Intergenic
1181047720 22:20223514-20223536 AGGGGGTCTGGGAGGCTGAGAGG + Intergenic
1182470893 22:30547566-30547588 GGGACTTCTGGGAGACAGCAGGG + Intergenic
1182709173 22:32310031-32310053 AAGACCTCTGGGTGGCAGCGGGG + Intergenic
1183269388 22:36851154-36851176 AGGGTTTGTGGGAGGAAGGGAGG - Intergenic
1183429874 22:37759088-37759110 AGGGCTGGTGGAAGGCAGTGAGG - Intronic
1183830654 22:40416950-40416972 AGGCCGTCAGGGAGGCAGCAGGG + Intronic
1184352602 22:43954511-43954533 AGGGTTTCTGGGAGGGAGTAAGG + Intronic
1184437351 22:44487444-44487466 TGGGCCTTTGGGAGGCAGTGAGG - Intergenic
1184457368 22:44618766-44618788 AGGGCTCCTGGGCGGGAGCTGGG + Intergenic
1184857521 22:47154554-47154576 AGGGCTTCAGGGAGCCAGCCTGG - Intronic
1185004367 22:48267037-48267059 AGGACTTCTGGGTGGGAACGGGG + Intergenic
1185200276 22:49498352-49498374 AGGGGTTCTGAGAGGCAGCAAGG - Intronic
1203284952 22_KI270734v1_random:150163-150185 ATGCCTTCTGGGAGGCAGTGGGG + Intergenic
949414420 3:3799948-3799970 AGGAGGTGTGGGAGGCAGCGAGG + Intronic
950012061 3:9731225-9731247 GGGGCTTGTGGGAGGGGGCGGGG - Intergenic
950421686 3:12903361-12903383 CGGGCAGCTGGGAGGAAGCGGGG - Intronic
950664671 3:14488053-14488075 AGGGCTGCTGGGAGGAAGGAGGG - Exonic
952849380 3:37714887-37714909 CGGGCATCTGTGAGGCAGCATGG + Intronic
954154492 3:48677914-48677936 AGGGCATCAGGGAGGCAGTGGGG - Intronic
954156418 3:48687335-48687357 AGGGCTTCTGGGAGGAGGAAGGG - Intergenic
954584471 3:51721282-51721304 GGGGGTTATGGGAGGCAGAGGGG + Intergenic
954909105 3:54088049-54088071 CGGGCCCCTGGGCGGCAGCGTGG + Intergenic
955558998 3:60168526-60168548 AGAGCCTCTGGCAGGCAGAGTGG - Intronic
956720799 3:72115755-72115777 GGGGCCTCTGGGAGGCAACTGGG - Intergenic
956835669 3:73094430-73094452 TGGGCATCTGGGAGGAAGCAGGG - Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
959811695 3:110627316-110627338 AGGGCTTTTGGGAGGTAACTAGG + Intergenic
960155661 3:114295143-114295165 AGGTCTTCTAGGAGGCGGGGAGG + Intronic
960970437 3:123135408-123135430 AGGGCTTCTTGGGGGCCACGTGG + Intronic
961644040 3:128383011-128383033 AGGTCTTCCAGGAGGCAGGGAGG - Intronic
962448755 3:135493734-135493756 TGGGCCACTGGGAGGCAGGGTGG - Intergenic
962753472 3:138451304-138451326 GGGGCTTCTGGGAGCCAAGGTGG + Intronic
962773359 3:138634403-138634425 AGGGTTGCAGGGCGGCAGCGTGG + Intergenic
965781765 3:172293651-172293673 AAGGCTACTGGGAGGTAGTGAGG + Intronic
966723396 3:183086743-183086765 AGCTCTGCTGGGAGGGAGCGGGG + Exonic
967424589 3:189311905-189311927 AGGGCTTCAGGGGGACAGAGTGG + Intronic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
967970257 3:194994202-194994224 AGAGGGGCTGGGAGGCAGCGAGG - Intergenic
968238790 3:197055962-197055984 AGGGTTTGTGGGAGCCAGTGTGG - Intronic
968370285 3:198219607-198219629 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
968622518 4:1610310-1610332 AGGTCTTCCGGCAGGCAGCTGGG - Intergenic
968935621 4:3608669-3608691 AGGGCTTCCTGGAGGCACTGGGG + Intergenic
969282655 4:6181558-6181580 AGGGCCTATGGGTGCCAGCGTGG + Intronic
969509095 4:7607427-7607449 AGGGCTTCACGGAGGAAGAGTGG - Intronic
969582428 4:8072982-8073004 AGGGTCTCTGAGAGGCAGTGGGG + Intronic
969657543 4:8506922-8506944 AGAGCTTCCTGGAGGCAGCGTGG + Intergenic
969704151 4:8782943-8782965 GGGGCTTCTGGAAGCCAGCATGG + Intergenic
969721669 4:8895636-8895658 AGGGCCTATGGGATGCAGGGTGG + Intergenic
970494148 4:16608795-16608817 AGGGCTTCTGACAGGGAGAGAGG + Intronic
970697212 4:18692089-18692111 AGGGCTTGTGGCATGCAGTGGGG + Intergenic
976077562 4:81316820-81316842 AGGACTTCTGAGAGGTGGCGTGG - Intergenic
978443873 4:108762661-108762683 AGCGTTTCTGGGAGTCCGCGCGG + Intronic
979366425 4:119829929-119829951 AGGTCTCCTGAGAGGCAGCCTGG - Intergenic
982019311 4:151187955-151187977 AGGGAGTCTGGGAGGGAGAGGGG - Intronic
982605112 4:157505962-157505984 AGGGCTTTTGGGAAGCAGCTAGG - Intergenic
983373050 4:166887880-166887902 AGAGCTCCTGAAAGGCAGCGTGG + Intronic
984453427 4:179933822-179933844 AGGACTTCGGGGAGCCAGCTGGG + Intergenic
984596825 4:181678413-181678435 AGGTCTTGAGGGAGGCAACGGGG + Intergenic
985118438 4:186615657-186615679 AGGACTTTGGGGAGGCAGGGTGG - Intronic
987201452 5:15581852-15581874 TGGACTTCTGGGAGGGAGCCGGG - Intronic
988734642 5:34008070-34008092 AGGGCTTCTTGCAGGCTGCTGGG - Intronic
988959903 5:36359338-36359360 AGGGCGCCTGGGAGGCAGTTTGG - Intergenic
992611965 5:78515775-78515797 AAGGCCACTGTGAGGCAGCGTGG + Intronic
996535905 5:124577572-124577594 AAGGCTTCTGGGAGACATTGGGG - Intergenic
996645909 5:125816795-125816817 AGGGCTTCTGGGAGGTAATTAGG - Intergenic
997275196 5:132581004-132581026 AGGGCTTCTGGGAGGAGGTAGGG + Intronic
997319107 5:132963384-132963406 AGGGGCTCCGGGAGGCGGCGGGG + Exonic
997844685 5:137275964-137275986 AGGGCTCAGGGGAGGCAGGGAGG - Intronic
998134419 5:139667256-139667278 AGGGCTTCTTGGAGGAGGTGAGG - Intronic
998566189 5:143217808-143217830 AGGGGTTCTGGGAGCAAGAGTGG - Intronic
999383662 5:151139479-151139501 TGGGCTTCCTGGAGGCAGGGTGG - Intronic
999394996 5:151221700-151221722 AGGGCTTCTGTGAGACTGGGCGG + Intronic
999861875 5:155656833-155656855 AGGGCATCTGGGAGGGAGACTGG + Intergenic
1000050791 5:157561467-157561489 AGGGCTTCTGGGACTCTGGGGGG - Intronic
1000407068 5:160899380-160899402 AAGGCTTTTGGGAGACAGGGTGG + Intergenic
1001097957 5:168790425-168790447 AGGGCCTCTGGGAAGGAGCCAGG - Intronic
1001658458 5:173372502-173372524 AGGGCATCTGGGAGGTAGGAAGG - Intergenic
1001791492 5:174461216-174461238 CTGGCTTCTGGGGGGCAGAGGGG + Intergenic
1002483401 5:179517976-179517998 AGGTCTCCTGGGAGTCAGAGGGG + Intergenic
1002594326 5:180312212-180312234 AGGGAGGCAGGGAGGCAGCGCGG + Intronic
1002729817 5:181326367-181326389 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1003349161 6:5299686-5299708 AGGGCTTCTTGGAGGGTGGGGGG - Intronic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1004791961 6:19036445-19036467 AGGGCTTTTGGAAGGGAGAGTGG + Intergenic
1006396949 6:33793722-33793744 AGGGCATGCGGGGGGCAGCGGGG - Intergenic
1006437327 6:34032847-34032869 TGGGCTGCTGGCAGGCAGCCAGG + Intronic
1007121895 6:39389012-39389034 ATGGATTGTGGGTGGCAGCGGGG + Intronic
1007380599 6:41488070-41488092 AGGGATTATGGGAGACAGCATGG + Intergenic
1007632797 6:43282225-43282247 AGGGCATCTAGGAGCCAGCCCGG + Intronic
1007806896 6:44457098-44457120 AGAGCTTTGGGGAGGCAGAGTGG + Intergenic
1009905605 6:69867234-69867256 GCGGCTTCTGGGGGGCGGCGCGG + Intronic
1009925782 6:70119119-70119141 AAGGGTTCTGGGAGGCAGTAAGG - Intronic
1010125384 6:72425866-72425888 AGGGCTTCTGGAAGGCACTAAGG + Intergenic
1011403371 6:86989177-86989199 AGGACATCTGGGAGGCAGTGTGG - Intronic
1013300229 6:108798355-108798377 AGGGCTGCGAGGAGGCAGCATGG - Intergenic
1015626334 6:135183067-135183089 AGGGGTGCTGGGAGGAGGCGCGG + Intronic
1017906310 6:158759393-158759415 AGGACTCCTGGGAGCCCGCGTGG - Intronic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019065655 6:169294426-169294448 AAGGCTTAAGGGAGGCAGGGAGG - Intergenic
1019304853 7:328483-328505 AGGCCTTCCGGGTGGCAGCAGGG - Intergenic
1019338168 7:494770-494792 GGGGCTTCTGTGAGGGAACGGGG + Intergenic
1019644459 7:2121568-2121590 TGGGCTCCTGGGAGGGAGTGGGG + Intronic
1019817802 7:3213934-3213956 CAGGCTCCTGGGAGGCAGCGTGG - Intergenic
1019928260 7:4207215-4207237 GAGGCTTCGGGGAGGCAGCCTGG - Intronic
1021106441 7:16644940-16644962 GGGGCTTCTGGAAGCCAGGGAGG + Intronic
1023167526 7:37357415-37357437 ACAGCTTCTGGGGGGCAGCTGGG - Intronic
1024077864 7:45831921-45831943 AGGAGTTCTTGGAGGTAGCGAGG + Intergenic
1024225408 7:47322760-47322782 AGGGCTTCTGTGATTCTGCGGGG - Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024549996 7:50554884-50554906 AAGTGTTCTGGGAGGCAGCATGG + Intronic
1024604544 7:51013117-51013139 CTGGCTTCTGGGAGGCAGGAGGG - Intergenic
1024638330 7:51309156-51309178 AGGGCAGCTTGGAGGCAGGGGGG - Intronic
1024645667 7:51368499-51368521 AGAGCTGCTGGGATGCAGGGAGG + Intergenic
1025052923 7:55743908-55743930 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025126552 7:56349502-56349524 AGGAGTTCTTGGAGGTAGCGAGG - Intergenic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025695640 7:63772950-63772972 AGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1025739652 7:64184308-64184330 AGGGGTCCTGGCAGGCAGAGCGG + Intronic
1025801875 7:64794400-64794422 ACGTCTTCCGGGAGGCGGCGGGG + Exonic
1026229681 7:68472061-68472083 AGGGTTTCTGGGGAGCAGGGAGG - Intergenic
1027160816 7:75800803-75800825 AGCTCTGCTGGGAGGCAGAGGGG - Intergenic
1027251937 7:76404333-76404355 AGGGCTTGGGGGAGGAAGGGAGG + Exonic
1027270055 7:76514100-76514122 AGGGGTTCTGGGTGGGAGAGGGG - Intronic
1029262771 7:99314606-99314628 AGGGCTTGTGGGAAGAAGAGTGG + Intergenic
1029360057 7:100081852-100081874 AGGGCGGCTGGCAGGCGGCGAGG + Intronic
1029416126 7:100444374-100444396 AGGGCTGCGAGGAGGCAGAGAGG - Intergenic
1029708154 7:102286265-102286287 AGGGCTGCAGGGAGGGGGCGTGG + Intronic
1029714559 7:102318883-102318905 AGGCCCTCTGGGAGGCTGCCTGG - Intronic
1031969081 7:128050842-128050864 AAGGGCTCTGGGAGGCAGCAGGG + Intronic
1032051533 7:128653488-128653510 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1032405409 7:131652248-131652270 AGGGCTAGCAGGAGGCAGCGAGG + Intergenic
1033647690 7:143317793-143317815 AAGGTTTCTTGGAGACAGCGGGG + Intronic
1034228019 7:149497781-149497803 GAGGCTTCCTGGAGGCAGCGCGG + Exonic
1034264841 7:149775917-149775939 TGGGCTGCGGGGAGGCTGCGTGG + Intergenic
1034446355 7:151116015-151116037 AGTGCCTCTGGGAGCCAGGGAGG + Intronic
1035361720 7:158317962-158317984 AGGGAATCCGGGAGGCAGCCTGG + Intronic
1035457173 7:159016181-159016203 TGGGCTTCTGAAAGGCAGCTCGG - Intergenic
1035612484 8:977724-977746 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612499 8:977777-977799 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612512 8:977830-977852 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612525 8:977883-977905 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612538 8:977936-977958 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612551 8:977989-978011 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612566 8:978042-978064 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612581 8:978095-978117 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612608 8:978201-978223 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612623 8:978254-978276 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612638 8:978307-978329 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612652 8:978360-978382 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612664 8:978413-978435 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612675 8:978466-978488 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1035612702 8:978572-978594 AGGGCGTCGGGGATGCAGTGAGG + Intergenic
1037273758 8:17156612-17156634 CGGGCTCCTGGGCGGCGGCGGGG - Exonic
1037901732 8:22692765-22692787 AGGGCGGCGGGGAGGCGGCGAGG - Intronic
1037946793 8:22994604-22994626 AGGTCTTCTGGGGGCCATCGGGG - Exonic
1038780597 8:30565995-30566017 GAGGCTTCTGGGGGCCAGCGAGG - Intronic
1039906183 8:41787928-41787950 AGGGGTACTGGGGGGCAGGGTGG - Intronic
1039906728 8:41791830-41791852 ATGGTGTCTGGAAGGCAGCGGGG - Intronic
1040850955 8:51899624-51899646 AGGGCGCCTGGCAGGCAGGGCGG - Intergenic
1042307064 8:67343485-67343507 ACGGCTTCTTGGGGGCGGCGAGG - Exonic
1043388630 8:79770133-79770155 GGGACTTCTGGAAGGCAGAGGGG - Intergenic
1043881521 8:85548838-85548860 AGGAATTCTGGGAGGCATCCAGG + Intergenic
1044357617 8:91242528-91242550 AGGGCCTCTGGGAGGCAGTTAGG + Intronic
1045017767 8:98013600-98013622 AGGGTTTCTGGGATGCTGCCTGG - Intronic
1046193391 8:110829556-110829578 AGTGCTTCTGTGGGGCAGTGAGG - Intergenic
1046691832 8:117294367-117294389 AGTGATTCTGGAAGGAAGCGAGG + Intergenic
1047528003 8:125650158-125650180 TGAGTTACTGGGAGGCAGCGTGG - Intergenic
1048319773 8:133389325-133389347 CTGGCTTGTGGGAGGCAGCAGGG - Intergenic
1048983371 8:139715317-139715339 AGGGCATCAGGGAGGAAGAGGGG + Intergenic
1049214901 8:141403031-141403053 AGGGCTGCTGGGAGGCTGGACGG - Intronic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049602713 8:143515338-143515360 AGGGCCCCTGGGGCGCAGCGAGG + Intronic
1050289662 9:4140579-4140601 GGGACTTCTGGGAGGAAGCTGGG - Intronic
1051911152 9:22154794-22154816 AGGGGTCCTGGCAGGCAGTGTGG + Intergenic
1054161395 9:61674167-61674189 AGCGCTTCGGGGCGGCGGCGAGG + Intergenic
1054454563 9:65423202-65423224 AGGGCTTCCTGGAGGCACTGGGG - Intergenic
1054792138 9:69266192-69266214 AGGGAGCCTGGGAGGCTGCGAGG + Intergenic
1057182262 9:93036520-93036542 AGGGCCTCTGGGAGAGAGTGGGG + Intergenic
1057487791 9:95499534-95499556 AGAGGTTCTGGGAGCCAGCGAGG + Intronic
1057909414 9:99005975-99005997 AGTGCTGCTGAGAGGCAGAGAGG - Intronic
1059307709 9:113367757-113367779 AAGGCTTCTGGGGGGCACAGGGG + Intronic
1059332519 9:113544670-113544692 AAGGCTGCTGGGAGGCTGGGGGG - Intronic
1060103836 9:120861541-120861563 AGGGCTTCAGGGAGGTGGTGGGG + Intronic
1061238273 9:129354361-129354383 AGGCCTTCTGGGTGGCAGGGTGG + Intergenic
1061298097 9:129687902-129687924 AGGGCTTTCTGGAGGTAGCGGGG + Intronic
1061386636 9:130294540-130294562 AGGGCTTCCTGGAGGAAGTGTGG + Intronic
1061912287 9:133731577-133731599 AAGGCTTCTGGGAGAAAGTGAGG - Intronic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1062545806 9:137063361-137063383 AGGGGCCCTGGCAGGCAGCGTGG - Exonic
1062622645 9:137429681-137429703 AGGGACTCTGGGAGGCTGCAAGG - Intronic
1062728819 9:138096982-138097004 AGGGCTTGTGGGAGGGTGTGTGG + Intronic
1062754229 9:138278879-138278901 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203577789 Un_KI270745v1:21636-21658 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1186402411 X:9271921-9271943 GGGTCCTCTGGGAGGAAGCGTGG - Intergenic
1188549062 X:31342166-31342188 AGGGCTCCTGGGTGGGAGTGGGG + Intronic
1189254649 X:39628548-39628570 AGGGATGCTGAGAGGAAGCGAGG - Intergenic
1191177218 X:57517017-57517039 AGGGCTCCTGGGAAGCACCTTGG + Intergenic
1192235011 X:69290021-69290043 AGAGCCTCTGGGAGGCAGGGTGG + Intergenic
1193149334 X:78108304-78108326 AGGCCTTCTGGGAGGTTGCATGG + Intronic
1195738965 X:108042964-108042986 AGGGTTTCTGGGAGGAATAGAGG + Intergenic
1199595215 X:149501663-149501685 AGGACTTCTAGGAGCCAGTGAGG + Intronic
1200214276 X:154360548-154360570 GGGGCTGCAGGGAGGCAGTGCGG - Exonic
1200684355 Y:6246071-6246093 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1200989877 Y:9337312-9337334 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1200992545 Y:9357645-9357667 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1200995197 Y:9377923-9377945 AGGGCTTCTCGGAGGAGGCTTGG + Intronic
1200997862 Y:9398269-9398291 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1201000371 Y:9466802-9466824 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1201003033 Y:9487115-9487137 AGGGCTTCTCGGAGGAGGCTTGG + Intronic
1201005692 Y:9507398-9507420 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1201008352 Y:9527728-9527750 AGGGCTTCTCGGAGGAGGCTTGG + Intergenic
1201010946 Y:9547910-9547932 AGGGCTTCTCGGAGGAGGCTCGG + Intergenic
1201048279 Y:9908315-9908337 AGGGCTTCTCGGAGGAGGCTTGG - Intergenic
1202380884 Y:24276087-24276109 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1202489900 Y:25394038-25394060 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic