ID: 958720553

View in Genome Browser
Species Human (GRCh38)
Location 3:97837927-97837949
Sequence CCTCCTGTAATGCACCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958720553 Original CRISPR CCTCCTGTAATGCACCTGTT GGG (reversed) Intronic
901393424 1:8963242-8963264 CCTCCTGCAATTCACCTGACCGG + Intronic
903706079 1:25286858-25286880 CCTCAGGTAATCCACCTGCTAGG - Intronic
907451151 1:54546748-54546770 CCTCCTGTTCTGCGCCTGTCAGG + Intronic
907588290 1:55641225-55641247 CCTCCTGTAAAGCAAGTTTTAGG - Intergenic
910184726 1:84525869-84525891 CTTCCTGTAATGGACCATTTAGG + Intergenic
918007414 1:180554799-180554821 CCCCATTTAACGCACCTGTTTGG + Intergenic
1069491985 10:68868726-68868748 TCTCCTGTAGGGCACCAGTTAGG - Intronic
1074505473 10:114066602-114066624 CCCCGTGAAATGCATCTGTTCGG + Intergenic
1075382532 10:122030937-122030959 CCTCCTGTGATCCCCCTCTTGGG + Intronic
1078811922 11:14776473-14776495 CCTACTGTAAGGCACCAGTGTGG + Intronic
1079457943 11:20652887-20652909 CCTCCTGTTGTGCCTCTGTTAGG + Intronic
1089076926 11:115745773-115745795 CCTGCTATAATGCAACTGTCAGG + Intergenic
1090005496 11:122998748-122998770 CCTCCTGCTATGCACCTGATGGG + Intergenic
1101597324 12:106178574-106178596 CCTCCATTAATGCCCCTCTTTGG - Intergenic
1102160396 12:110764043-110764065 CCTCAGGTGATCCACCTGTTCGG - Intergenic
1105594401 13:21822943-21822965 GGTCCTGTAATTCACCTGTGTGG + Intergenic
1106502501 13:30342480-30342502 CCTCCTGAAGTGAACCTCTTTGG + Intergenic
1106585280 13:31051830-31051852 CCTTCTGTAATGCTCCTTCTCGG + Intergenic
1110430154 13:75414008-75414030 CCTCCTGTGATGCTTGTGTTTGG + Intronic
1111660420 13:91203292-91203314 CTTCATGAAATGCACTTGTTTGG - Intergenic
1111690887 13:91561437-91561459 CCTCATTTAATTAACCTGTTTGG + Intronic
1113758464 13:112831140-112831162 CCTCCTGAATTGCACCTGCCAGG + Intronic
1119349045 14:73949344-73949366 ACTCCTGTAATGCAGCACTTTGG - Intronic
1119744618 14:77035194-77035216 ACTCCAGTAATCCACCTGCTTGG + Intergenic
1122458489 14:101876221-101876243 CCTCCTGTGATGGAACTGTTAGG - Intronic
1122611698 14:102988263-102988285 ACTCCAGTTATGCATCTGTTGGG - Intronic
1123467708 15:20528837-20528859 CCTTCTCTAATGTACCTATTTGG - Intergenic
1123728020 15:23124046-23124068 CCTTCTCTAATGTACCTATTTGG - Intergenic
1123740813 15:23281047-23281069 CCTTCTCTAATGTACCTATTTGG + Intergenic
1123746185 15:23321511-23321533 CCTTCTCTAATGTACCTATTTGG - Intergenic
1124278452 15:28344828-28344850 CCTTCTCTAATGTACCTATTTGG - Intergenic
1124304248 15:28566780-28566802 CCTTCTCTAATGTACCTATTTGG + Intergenic
1126452950 15:48829684-48829706 CCTCAGGTAATCCACCTGCTTGG - Intronic
1127640007 15:60907608-60907630 TCACCTGTAATGTGCCTGTTAGG + Intronic
1130717577 15:86350794-86350816 CCTCTTGTTATGCTCCTGTTAGG + Intronic
1132424298 15:101701474-101701496 CCTCCTGCAATGAACTTTTTTGG - Intronic
1132677867 16:1128091-1128113 CCTGCTGTCCTGCACCTCTTCGG + Intergenic
1134683373 16:16141969-16141991 CCTCCTGGAAGGGACCTGGTTGG + Exonic
1135170166 16:20176869-20176891 CCTCATGTGATCCACCTGCTTGG + Intergenic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1144584765 17:16481574-16481596 CCTCCTGCAGTGCACCTGCCGGG - Intronic
1146723044 17:35136760-35136782 CCTCCTGTAGGACAGCTGTTGGG - Intronic
1152545728 17:80999282-80999304 CCTCCTGCAATGCGCCTGCGTGG - Exonic
1155782997 18:29862539-29862561 CATCCTGTTATTCAGCTGTTAGG + Intergenic
1157348426 18:46862096-46862118 CCTCAAGTGATCCACCTGTTCGG - Intronic
1158699797 18:59735578-59735600 CCTCCTGTAATGTGCATATTGGG + Intergenic
1163982374 19:20913177-20913199 CCTCCTGTAATGAATGAGTTGGG - Intergenic
1164904486 19:31955903-31955925 CCTCATGTATTCCACCTGTTGGG - Intergenic
1166612013 19:44207211-44207233 ACTCCTGTAGTGCAGCTCTTTGG + Intergenic
1167881629 19:52463745-52463767 CCACCTGTAATTTAGCTGTTTGG + Intronic
925213772 2:2074428-2074450 CCTTTTGTAATGCACTTCTTTGG - Intronic
926657422 2:15423830-15423852 CCTTCTCTAATGCAGCTGTTTGG + Intronic
929959679 2:46487180-46487202 CCTCCTGATTTCCACCTGTTCGG - Intergenic
933426292 2:82115969-82115991 ATTGCTGTAATGAACCTGTTTGG + Intergenic
937411277 2:121678625-121678647 CCTCAGGTAATGCACCTGCCTGG - Intergenic
937706739 2:124929674-124929696 ACTCATGTAAAGCACATGTTTGG - Intergenic
941315471 2:163986717-163986739 GCTATTGTAAGGCACCTGTTAGG - Intergenic
943679855 2:190756835-190756857 CCTCATTTAATTCACCTGTCAGG - Intergenic
944603239 2:201324893-201324915 CCTCAAGTGATCCACCTGTTTGG - Intronic
947777568 2:232726107-232726129 CCACCTGTAATCCACCACTTTGG + Intronic
1172399490 20:34637435-34637457 CCAGCTGGAATGCATCTGTTTGG + Intronic
1172703213 20:36864828-36864850 CCTCCTGCACTGCTCCTGGTGGG - Intergenic
1173964851 20:47104786-47104808 CCTCATGTAATCCACCTGCCTGG - Intronic
1177214467 21:18110457-18110479 CCTCTTGGAATGCTCCTTTTTGG + Intronic
1178089673 21:29149415-29149437 CCTCATGGAATGCCCCTGTCTGG + Intronic
1178522050 21:33294640-33294662 CCTCCTGGCATGGACCTGTAGGG - Intronic
1180149277 21:45939451-45939473 CCTCCTTTCATTCCCCTGTTGGG - Intronic
1180867867 22:19129809-19129831 CCTCCTGTCTTGCACCTGCAGGG + Intergenic
951108311 3:18771137-18771159 TCTCCTGAAATTCACCTCTTTGG - Intergenic
951470460 3:23051028-23051050 CTCCCTGGTATGCACCTGTTTGG + Intergenic
952228019 3:31399201-31399223 CCTCCTGTTCTCCACCTGCTAGG - Intergenic
956178796 3:66499749-66499771 TCTCCTGTAATCCAACTATTTGG - Intronic
958720553 3:97837927-97837949 CCTCCTGTAATGCACCTGTTGGG - Intronic
966303968 3:178509993-178510015 ACTCCAGCAATGCACTTGTTGGG - Intronic
966570493 3:181437188-181437210 CACCCTGTAATCCAACTGTTAGG + Intergenic
966796291 3:183717123-183717145 CCTCAGGTAATCCACCTGTCTGG + Intronic
967097951 3:186193161-186193183 CCTCTTGGAATGCACCTACTTGG + Intronic
970146689 4:13043577-13043599 CCTCCTGGCATTCACCTTTTTGG + Intergenic
970338612 4:15081147-15081169 ACTCCTATAATGCACTTTTTTGG + Intergenic
977312167 4:95401189-95401211 CCTCCTGTATTGCACATGGTAGG - Intronic
978836897 4:113161819-113161841 CCTCTTGTAATGCCCCTGGAAGG - Intronic
983676695 4:170302887-170302909 TCTCCTGAGATGAACCTGTTAGG - Intergenic
985533684 5:449079-449101 ATTCCAGTAATGCACCTTTTTGG - Intronic
985590310 5:761194-761216 CCTCCTGTATTGCACCTTCATGG - Intronic
995724182 5:115167255-115167277 TCTTCATTAATGCACCTGTTTGG + Intronic
996766695 5:127041382-127041404 ACTCCTGTAAGGCACTTGTCAGG - Intergenic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
1001830028 5:174778502-174778524 CCACCTGTAATCCAGCTGCTGGG - Intergenic
1002846241 6:947721-947743 CCTCATGTCACTCACCTGTTAGG - Intergenic
1004993980 6:21170234-21170256 CCTCCTGTAATACATGGGTTAGG + Intronic
1005944707 6:30586843-30586865 CCTCCTCTACTGCCCCTCTTAGG - Intronic
1006764302 6:36491238-36491260 CCTCAAGTGATCCACCTGTTTGG - Intergenic
1007533760 6:42565790-42565812 CCTCAGGTGATCCACCTGTTTGG + Intronic
1008636734 6:53418272-53418294 CCTCCTTTAACTCATCTGTTTGG + Intergenic
1010985622 6:82420620-82420642 CCTCAAGTAATCCACCTGCTTGG + Intergenic
1017661893 6:156683012-156683034 CATTCTGGAATGCACCAGTTGGG - Intergenic
1017861887 6:158406064-158406086 CCTCCCTGAATGCACCTGTTTGG + Intronic
1019337104 7:490731-490753 CCTTCTGAAATGCAGCTGTAGGG + Intergenic
1019418083 7:936423-936445 CCTCAAGTAATCCACCTGCTCGG + Intronic
1023897719 7:44448015-44448037 CAGGCTGTAATGCACCTGTCAGG + Intronic
1024116534 7:46199519-46199541 CCTACTCTAAGGAACCTGTTTGG + Intergenic
1024516854 7:50266681-50266703 GCTCCTGAAATGCACGTGTCAGG - Intergenic
1027349801 7:77299619-77299641 TATCCTGTATTTCACCTGTTGGG + Intronic
1029124288 7:98286184-98286206 CCTCCTGTAAAGTGCCTGTGGGG + Intronic
1029389245 7:100264014-100264036 CCTCAGGTGATGCACCTGCTTGG + Intronic
1033175313 7:139118429-139118451 TCTCCTGTAGAACACCTGTTTGG - Intergenic
1033291223 7:140084433-140084455 CCTACTGTACTGCAGGTGTTAGG + Intergenic
1033362409 7:140647017-140647039 CCTCCTGGATTGCATCTGATTGG - Intronic
1033473114 7:141666529-141666551 CATCCTTTAATGTATCTGTTTGG - Intronic
1037300498 8:17446514-17446536 CCTCCTGTAAAACATCTGCTTGG - Intergenic
1042745582 8:72102683-72102705 CCTCCTGTAATGCTCCAGGCAGG + Intronic
1042804142 8:72753944-72753966 CCTGCAGCATTGCACCTGTTGGG + Intronic
1044880947 8:96721653-96721675 TCTCCTGTCATTCTCCTGTTTGG + Intronic
1045709645 8:104968150-104968172 TCTCCTGTAATGCAGTAGTTAGG - Intronic
1048289229 8:133167494-133167516 CCTCCTGTAATGAAGCTGCCTGG - Intergenic
1062278035 9:135739784-135739806 CACCCTAGAATGCACCTGTTTGG + Intronic
1188493235 X:30757396-30757418 CCTCAAGTAATCCACCTGTCTGG + Intergenic
1192407265 X:70898923-70898945 CCACCTGGTATGCACCTATTAGG - Intronic
1194448591 X:94015421-94015443 CCTCCTGTAATGCTCCAGGTGGG + Intergenic
1200205221 X:154310761-154310783 CCTCCTGAAATGCATTTGTTTGG + Intronic