ID: 958723482

View in Genome Browser
Species Human (GRCh38)
Location 3:97875250-97875272
Sequence TGATGTAGTTAGAGAGTTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958723482 Original CRISPR TGATGTAGTTAGAGAGTTCT TGG Exonic
905041796 1:34966573-34966595 TGCTGTACTTAGAGTGTTCAAGG + Intergenic
905715580 1:40146694-40146716 TGATGTATTGAGAGATATCTAGG + Intergenic
909210905 1:72821935-72821957 TGAGGAAGATAGAGAGGTCTGGG + Intergenic
909357889 1:74730220-74730242 TAATGTAGTCAGATAGTACTGGG - Intronic
910300220 1:85697565-85697587 TGATCTAGTTACAGATTTCTAGG + Intronic
910462758 1:87466520-87466542 TCATGTAGTTTCAGAGTTATGGG + Intergenic
916840119 1:168591575-168591597 TGATATGCTTAGAGAGTCCTGGG + Intergenic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
920841647 1:209560485-209560507 TAATGTACTTGGAGACTTCTAGG - Intergenic
924860863 1:247921053-247921075 TGGTGTGGTTAAAGAGTCCTAGG - Exonic
924890564 1:248273757-248273779 TGGTGTGGTTAAAGAGTCCTAGG + Exonic
924892218 1:248295521-248295543 TGGTGTGGTTAAAGAGTCCTAGG + Exonic
1063374956 10:5548723-5548745 TGATGTCGTTAGTCAGTCCTGGG + Intergenic
1065385701 10:25131169-25131191 TAATGTGGTGAGAGACTTCTGGG - Intergenic
1066539238 10:36427274-36427296 TGATGCAGTTAGAAAATTATAGG + Intergenic
1068006848 10:51401359-51401381 TGATTTGGTTACAGAGTGCTTGG + Intronic
1069828808 10:71270410-71270432 CCATGAAGTTAGAGGGTTCTGGG + Intronic
1071139898 10:82496494-82496516 TCATGTCAATAGAGAGTTCTGGG - Intronic
1071789722 10:88941271-88941293 TGAGGTAGTCAGTGAGATCTCGG + Exonic
1078263206 11:9731292-9731314 TGATGTGGTTTAAGAGTTCGAGG + Intronic
1082140382 11:48602335-48602357 TAATGTAGTTCAAGACTTCTTGG + Intergenic
1082647285 11:55743408-55743430 TGATTTGGTTATATAGTTCTTGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083378792 11:62247422-62247444 TGATGAAGTGAGAGAGAACTTGG - Intergenic
1085943629 11:81238432-81238454 TGATGTATTTACAGAGTTAAAGG - Intergenic
1089066242 11:115664227-115664249 TGGGGTAGATAGAGATTTCTAGG - Intergenic
1090902082 11:131041437-131041459 TGATGTGTTGAGAGACTTCTTGG - Intergenic
1092013693 12:5138858-5138880 TGGTGTAGTTGGACATTTCTAGG + Intergenic
1100675458 12:96861781-96861803 TGATGTAATAATAGAGTGCTGGG + Intronic
1101769422 12:107735225-107735247 TGATTTAGCTATATAGTTCTTGG - Intronic
1102083118 12:110114438-110114460 TGGTGTATTTATAGAGTTCAGGG - Intergenic
1103763882 12:123268809-123268831 TGATGTAGTTAGGGGGCTCTGGG - Intronic
1105610571 13:21965715-21965737 TTATGTAGTAAAAGACTTCTGGG + Intergenic
1109708150 13:66126855-66126877 TGATGGAATTAAAGAGTCCTAGG - Intergenic
1110667917 13:78139446-78139468 TGATGGGGTTAGAGTGTTATAGG + Intergenic
1111365693 13:87241486-87241508 GGATGTATTTAGAGTGTTCAAGG + Intergenic
1113100198 13:106709447-106709469 AGATGTGGTTGGAGAATTCTGGG + Intergenic
1116211184 14:41946913-41946935 TGAGGTAATTAGGGAGTTTTAGG - Intergenic
1116631395 14:47339515-47339537 GGATGTAATGAGTGAGTTCTTGG + Intronic
1117713639 14:58558352-58558374 TGATGTAGTTAGAAATTTTCAGG + Intergenic
1119951986 14:78754538-78754560 TGATGTAGTTAGAGAAGTTAGGG - Intronic
1121106963 14:91286951-91286973 TAAAGTAGTTAGAGGGTGCTGGG + Intronic
1122136223 14:99634515-99634537 TGCTGTAGTTAGAGAAGTATGGG - Intergenic
1124346667 15:28927525-28927547 TGATGTTGTTCCACAGTTCTTGG + Intronic
1124831947 15:33157514-33157536 CAATGTAGTGAGAGAGATCTGGG - Intronic
1127714176 15:61632252-61632274 TGATGTAGCCAGAGATGTCTGGG - Intergenic
1130101050 15:80894266-80894288 TGATGTAGTTACATAAGTCTGGG + Intronic
1130832299 15:87613780-87613802 TGTTGTAGTTTGGGAATTCTTGG - Intergenic
1132506522 16:312478-312500 TGTTGTAGTAACAGAGTTTTGGG + Intronic
1133379712 16:5319823-5319845 TGATGTAGTCACAGAGTTGAAGG - Intergenic
1136991324 16:35152919-35152941 TGCTGTAGTCAGAGGGTCCTAGG - Intergenic
1139199880 16:64963836-64963858 TCTGGTAGTTAGAGAATTCTAGG - Intronic
1146912035 17:36654711-36654733 TGAGGTAGGCAGAGATTTCTTGG + Intergenic
1148434301 17:47670154-47670176 TGATTAAGGTAGAGAGTTTTTGG + Intronic
1149036983 17:52146129-52146151 TAAAGCAGTTAGAGAGTTGTAGG - Intronic
1150050660 17:61958973-61958995 TGATGGAGTCAGAGAGACCTGGG - Intronic
1152264127 17:79283807-79283829 TGAAGCAGTCATAGAGTTCTAGG - Intronic
1155126102 18:22877309-22877331 TGATTTAGTCGGTGAGTTCTGGG - Intronic
1156582756 18:38396324-38396346 TGATGAACTTAGATAGTTTTGGG + Intergenic
1160421410 18:78749359-78749381 TGAGGTATTTTGAGAGATCTTGG + Intergenic
1164985348 19:32644414-32644436 TGAAGATGTGAGAGAGTTCTTGG - Exonic
1166464996 19:43024280-43024302 GGATTTAGGTACAGAGTTCTGGG + Intronic
929727981 2:44452195-44452217 TGAAGTGTTTAGAGAGTTTTAGG + Intronic
929886865 2:45886534-45886556 CCATGTAGTTAGGTAGTTCTGGG - Intronic
930793960 2:55368066-55368088 TGAAGTAGTTAGAGAGTCCTAGG - Intronic
931354838 2:61527564-61527586 TTTTGTATTTAGAGAGATCTTGG - Intronic
931720671 2:65065449-65065471 TGATGTCGTCAGTAAGTTCTTGG + Intronic
933437448 2:82265998-82266020 TGCTGTATTTTGAGAGCTCTGGG + Intergenic
934045861 2:88172023-88172045 TCATGTAGGTAGAGAGCTTTGGG + Exonic
934874754 2:97907130-97907152 AGATGTGGTTAGAGAGTTCTAGG + Intronic
936374653 2:111930229-111930251 TGCTTGAGCTAGAGAGTTCTGGG + Intronic
936780168 2:116023001-116023023 TGAGGTAGTTCCAGTGTTCTAGG + Intergenic
936923398 2:117712242-117712264 TGAGGCAATTAGAGAGTTGTGGG + Intergenic
937271503 2:120655764-120655786 TTATTGAGTTAGAGAGTTCATGG + Intergenic
937334524 2:121053845-121053867 TGAGATAGTGAGTGAGTTCTCGG + Intergenic
938261370 2:129897251-129897273 TCATGAAGTTAGACATTTCTGGG - Intergenic
942478423 2:176354491-176354513 TGATGTTGTACTAGAGTTCTAGG - Intergenic
942842856 2:180384011-180384033 TGTTGTAGTTATAGATTTTTTGG + Intergenic
943381514 2:187155680-187155702 TGATGTAGTCACACGGTTCTTGG + Intergenic
944532412 2:200680475-200680497 TGATGTAGTGAGAGGATTCCTGG - Intergenic
944633975 2:201656703-201656725 TGAGGTAGATAGAGAGTGATGGG + Intronic
944880524 2:204008291-204008313 TGATCTAGTTACAGAATTCAGGG - Intergenic
946681276 2:222219367-222219389 TGATTTTATTAGAGAGTGCTTGG - Intronic
946995825 2:225389891-225389913 GGATGGAGTTAGAGATTCCTGGG + Intergenic
947454188 2:230238168-230238190 TTATGTAGCTAGAGATTTATGGG - Intronic
948134354 2:235625199-235625221 TGCTGGAGTCAGAGAGTTCAAGG - Intronic
1169492682 20:6084386-6084408 TGGTGCAGTTGGAGAGCTCTGGG + Intronic
1169693883 20:8364905-8364927 TGAAGTAGCTATAGAGTTCCAGG + Intronic
1172089317 20:32417078-32417100 TGATGTAGATTGACAGGTCTAGG + Intronic
1174973192 20:55301641-55301663 TGAAGTATTGAGAGAGGTCTAGG + Intergenic
1178203980 21:30442031-30442053 GGAGGTAGTTGGAGAGGTCTGGG + Intergenic
1178266315 21:31145799-31145821 TAATGTAGTCAGTAAGTTCTTGG + Intronic
1180692005 22:17724636-17724658 TGATGTATGTAGAAAGTTTTTGG + Intronic
1180927710 22:19567562-19567584 AGATGTGTCTAGAGAGTTCTGGG + Intergenic
1181515765 22:23411094-23411116 TGTTGCATTTTGAGAGTTCTTGG + Intergenic
949186932 3:1202973-1202995 TGATGTAGCAAGAGAGTAATAGG + Intronic
952376475 3:32771666-32771688 AGATATAGTTAGGGAGTTTTTGG + Intronic
954528273 3:51293546-51293568 TGATCTAGGTAGGGATTTCTTGG + Intronic
958493224 3:94805512-94805534 TTACATAGTTAGAGACTTCTGGG - Intergenic
958723482 3:97875250-97875272 TGATGTAGTTAGAGAGTTCTTGG + Exonic
963852192 3:150220213-150220235 TGATGTGGTTAGAGATGCCTGGG - Intergenic
968405913 4:338779-338801 TGGTGTCGTTAGTGAGTTGTTGG + Intronic
973219785 4:47712047-47712069 TGATGTAGGTACAGAATTCCAGG - Intronic
974846298 4:67354493-67354515 TGATGAATTTAGCCAGTTCTGGG + Intergenic
976852960 4:89569363-89569385 TTCTTTAGTTAGTGAGTTCTGGG + Intergenic
977100682 4:92810217-92810239 TGATGAAATTAGAGATTTTTAGG + Intronic
978548665 4:109900685-109900707 GGAAGTTTTTAGAGAGTTCTGGG + Intergenic
978961017 4:114679090-114679112 TGATGAAGTTTGAGAATTATAGG + Intergenic
981142097 4:141280581-141280603 TTTTGTAGTCAGAGAGATCTTGG + Intergenic
984574943 4:181437285-181437307 TGAAGCAATTAGAGATTTCTGGG + Intergenic
985078265 4:186240245-186240267 TGATGTAGTTACAGTGATATAGG + Intronic
986676514 5:10190324-10190346 TGCTGTGGGGAGAGAGTTCTGGG - Intergenic
987188413 5:15448815-15448837 TGCTGTATGTAGAGAGTTCTAGG + Intergenic
988013699 5:25525965-25525987 TGATGTACTTTGAGATTTCTGGG - Intergenic
988986064 5:36620263-36620285 TGCTGTAGAAAGACAGTTCTGGG - Intronic
991190805 5:63871059-63871081 CGATGTAGTCAGAGAGCTCAAGG + Intergenic
992881427 5:81114189-81114211 TGGTATTGCTAGAGAGTTCTTGG + Intronic
993955979 5:94233842-94233864 TTATGTATATAGAGAGTACTTGG - Intronic
996868321 5:128155869-128155891 GCTTGTAGGTAGAGAGTTCTGGG + Intronic
997135143 5:131317546-131317568 TGATGTAGTAAGAGGGATCTTGG + Intronic
999097469 5:148992767-148992789 TGATGTAGTTAAAGAGCAGTGGG - Intronic
1000441807 5:161272437-161272459 TGATGTAACTAAAGAGTCCTGGG + Intergenic
1002018234 5:176343370-176343392 AAATGTATTGAGAGAGTTCTGGG - Intronic
1002312539 5:178323431-178323453 TAGTGTGGTCAGAGAGTTCTTGG + Intronic
1002378740 5:178809091-178809113 TGATCTAGTGAAAGAGATCTGGG + Intergenic
1008876570 6:56336114-56336136 TGATGTACTTTGAGAAATCTGGG - Intronic
1009561537 6:65251754-65251776 AGATGGAGTTAGAGAGTGATGGG + Intronic
1010233402 6:73555080-73555102 TGATTGACTTTGAGAGTTCTTGG - Intergenic
1012005061 6:93703475-93703497 GTATGTATTTATAGAGTTCTAGG + Intergenic
1014854787 6:126386441-126386463 TGATATAGTTAAATAGTACTGGG - Intergenic
1016182459 6:141163921-141163943 TGATGTAGATAGACAATTTTAGG - Intergenic
1017443195 6:154483683-154483705 TGAGTGAGTTAGAGAGTTGTTGG - Intronic
1017737061 6:157374967-157374989 GGATGTCATGAGAGAGTTCTAGG - Intergenic
1020349993 7:7209046-7209068 TGATTAAGTTAGAGGATTCTTGG - Intronic
1023691286 7:42790632-42790654 TCATTTAGTTCGAGACTTCTTGG - Intergenic
1027432738 7:78131442-78131464 TGATGAACCCAGAGAGTTCTGGG + Intronic
1028626897 7:92888004-92888026 TGATATAGTTCCATAGTTCTTGG + Intergenic
1030520928 7:110596970-110596992 TAATGTATTTGCAGAGTTCTGGG - Intergenic
1031192800 7:118576247-118576269 TGATTTAGTAGGAGAGATCTTGG + Intergenic
1031223713 7:119007400-119007422 TGATGTAGTCTGACAGATCTTGG - Intergenic
1031414378 7:121478227-121478249 TGATGATGTTAGGGAGATCTGGG - Intergenic
1031572402 7:123375521-123375543 TGATGTTGTTAGAGAAATATAGG + Intergenic
1033891953 7:146024377-146024399 TGAAGAGGTTATAGAGTTCTAGG - Intergenic
1036228356 8:6979465-6979487 TGATGTAGGTAATGATTTCTTGG + Intronic
1036230809 8:6998582-6998604 TGATGTAGGTAATGATTTCTTGG + Intronic
1036233255 8:7017681-7017703 TGATGTAGGTAATGATTTCTTGG + Intronic
1043067835 8:75598537-75598559 GGATGTAGATAAACAGTTCTTGG + Intergenic
1043131034 8:76461683-76461705 TGAAGTAGTTAAAGAGTTCATGG + Intergenic
1043497477 8:80818073-80818095 TCATGTAACTAGAGAGATCTGGG - Intronic
1046655716 8:116892126-116892148 TGAGGTAATGAGTGAGTTCTAGG - Intergenic
1047064198 8:121262271-121262293 TGATGCACTTGGAGAATTCTTGG + Intergenic
1048057777 8:130885004-130885026 TGAGGTATTTGGAGAGTTGTTGG + Intronic
1051989105 9:23129600-23129622 TGAACTAGCTTGAGAGTTCTAGG - Intergenic
1052172858 9:25423682-25423704 TGATGTAGATAAAGAGTTGTAGG + Intergenic
1055364873 9:75532543-75532565 AGATCTAGAGAGAGAGTTCTTGG + Intergenic
1055924050 9:81491881-81491903 TGGTGTAGTCACTGAGTTCTAGG - Intergenic
1059514234 9:114878081-114878103 AGATATAGTGAGAGAGTTGTGGG + Intergenic
1059787587 9:117602624-117602646 TGAAGTAGTTTCATAGTTCTAGG - Intergenic
1187299506 X:18033970-18033992 TGATTTATTTAGAGTGTGCTAGG + Intergenic
1188545627 X:31302899-31302921 TGATTTAGATTAAGAGTTCTAGG + Intronic
1189759200 X:44304187-44304209 TGATGTAATTAGAGAGTCCTAGG + Intronic
1192261758 X:69509817-69509839 TTTTATAGTTAGAAAGTTCTAGG + Intronic
1193309902 X:79994006-79994028 TGTTGTTGTTAGAGCGTTCAGGG - Intergenic
1193914413 X:87348281-87348303 TAATGTAAATAGATAGTTCTAGG - Intergenic
1196522840 X:116694397-116694419 TGAGGAAGTTAGGGATTTCTGGG + Intergenic
1196938737 X:120754961-120754983 AGATGAGGTTAGAGAGTTCATGG + Intergenic
1198476858 X:137002996-137003018 TAATGAAGTTGGAGAGCTCTGGG + Intergenic