ID: 958723516

View in Genome Browser
Species Human (GRCh38)
Location 3:97875741-97875763
Sequence CTCTTGCAATGTCAGATGTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958723511_958723516 27 Left 958723511 3:97875691-97875713 CCTTGTATGTATATCTGAAAAAA 0: 1
1: 0
2: 3
3: 45
4: 527
Right 958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG 0: 1
1: 0
2: 1
3: 15
4: 95
958723513_958723516 -1 Left 958723513 3:97875719-97875741 CCAGGACACAGTAAAAACACACC 0: 1
1: 0
2: 0
3: 27
4: 189
Right 958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG 0: 1
1: 0
2: 1
3: 15
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958723516 Original CRISPR CTCTTGCAATGTCAGATGTA GGG Exonic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
901494076 1:9611521-9611543 CTCTTTCAATGTCAGAGATCTGG + Intronic
902164696 1:14560879-14560901 TTCTTGCCATTTCGGATGTAAGG - Intergenic
904920198 1:34001666-34001688 CACTTGGAATGTAAAATGTATGG + Intronic
906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG + Intronic
906809002 1:48807494-48807516 CTCGTGCAATTTCAGAAGTGTGG - Intronic
910249744 1:85184506-85184528 ATCTTGCATTGTTACATGTAGGG - Intronic
910408610 1:86915541-86915563 CCCTGGCAATGTCAGATGAGGGG + Intronic
910506449 1:87954763-87954785 CTTTTGCAGTGTCAGATTTGTGG + Intergenic
911672136 1:100619382-100619404 CTCTTGAAATGTGAGTTGTTGGG + Intergenic
916156803 1:161858741-161858763 CTTTTGCATTTTCAGCTGTATGG - Intronic
917225668 1:172779205-172779227 CCCTTACAATCTCAGATGTCAGG + Intergenic
920782373 1:209006539-209006561 CCCTTGAAATGTCAGATATGAGG - Intergenic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
1066715705 10:38283645-38283667 CTCTGGCTCTGTCAGATGTTTGG - Intergenic
1071104750 10:82081229-82081251 CTCTTGGAATGTCAGATCTTGGG - Intronic
1073262989 10:102204478-102204500 ATCTTGCAAGATCAGATGTCTGG + Intergenic
1076162929 10:128259882-128259904 ATCTTGCAATCTAAGATGTGGGG - Intergenic
1078475847 11:11629237-11629259 CTCTAGGAATGGGAGATGTAAGG - Intergenic
1078627683 11:12972570-12972592 CTCATGCAAAGTCAGAAGTCAGG + Intergenic
1079312437 11:19378587-19378609 CTTTTGAAATGGCAGATGGAGGG + Intronic
1081265076 11:41010894-41010916 CTCTTACTTTGTCAGATGTAAGG + Intronic
1083368123 11:62155362-62155384 TTCTTGCAATGTCTGATTTGGGG - Intergenic
1084734421 11:71095091-71095113 CTCATTCAATGTCACATTTATGG + Intronic
1090072337 11:123554786-123554808 CTCTTGTTATAACAGATGTAGGG + Intronic
1090674739 11:128980681-128980703 CTCTTCCAATGTCAGCAGTTTGG + Exonic
1092053960 12:5493661-5493683 ATATTGCAGTGTCAGATGTGGGG - Intronic
1098433529 12:70445979-70446001 CTCCTGCACTGTGAGAAGTAGGG + Intergenic
1100409245 12:94298337-94298359 CAGTTGAAATGTCAGTTGTAGGG - Intronic
1101130958 12:101690687-101690709 CTTTTGCAATTTCAGATAAAGGG + Intergenic
1101551832 12:105770469-105770491 CTATTTAAATGTGAGATGTATGG - Intergenic
1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG + Intronic
1107331877 13:39310138-39310160 CTCATGGAAAATCAGATGTAGGG - Intergenic
1108708942 13:53014884-53014906 CACTTGCAAGGACAGATGGAAGG - Intergenic
1110474408 13:75896984-75897006 CTGTTGCAATGACAGATCTCTGG + Intergenic
1112747884 13:102548294-102548316 CTCTTGAAATGTCTGTTGTAGGG + Intergenic
1115716799 14:36114536-36114558 CTCTTGCAAGGTCAGATCAAGGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118987787 14:70771618-70771640 CTCCAGGAATGTCAGAGGTAGGG - Intronic
1119692227 14:76683514-76683536 GTCTTTCAATGATAGATGTAGGG - Intergenic
1121773258 14:96571707-96571729 CTTATCCAAAGTCAGATGTAGGG + Intergenic
1126213107 15:46122089-46122111 CCCTTGCTATGTCATCTGTAAGG - Intergenic
1135699491 16:24619649-24619671 CTCTTGCACTGGAAGATGAAGGG + Intergenic
1139029388 16:62860606-62860628 AACATGCCATGTCAGATGTATGG - Intergenic
1142964438 17:3571990-3572012 CTCTCCCAATGCCAGCTGTAGGG - Intronic
1144660452 17:17064599-17064621 TTCTTGAAATGTCAGATTTATGG - Intronic
1144803130 17:17944956-17944978 CTGCTGCAATGTCAGGAGTACGG - Intronic
1147278948 17:39341841-39341863 CACTTGTAATGTCATCTGTATGG + Intronic
1157870294 18:51224104-51224126 CTCTTGAAATGTAAGATATAGGG - Intergenic
1159681698 18:71361543-71361565 ATCTTCCAATGTCAGAAGCAAGG - Intergenic
1165692580 19:37875088-37875110 CTCCTGCCATGTCACCTGTAGGG + Intergenic
927127934 2:20030357-20030379 CTCCTGCAATGTAAGATGCTTGG - Intergenic
929550706 2:42889540-42889562 TTCTTGCATTTTCAGTTGTATGG + Intergenic
940369812 2:152888727-152888749 CTCTTGCAGTGTCTTGTGTAGGG + Intergenic
940490440 2:154352468-154352490 TTCATGCATTGTCACATGTAAGG + Intronic
945347974 2:208741515-208741537 CACTAGCAAAATCAGATGTATGG - Intronic
947133174 2:226950867-226950889 CTAATGCATTATCAGATGTATGG + Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1169636659 20:7699679-7699701 CTCTTGCAAAGTCAGAAATCAGG + Intergenic
1175673453 20:60926695-60926717 CTCTAGCAAAGGCAGTTGTAGGG + Intergenic
1179079076 21:38153507-38153529 CTTTTGCAATGCCAGCTGAAAGG - Intronic
1182064340 22:27419882-27419904 CTCTTGGAATTTCAGATGTTTGG + Intergenic
1184010550 22:41744842-41744864 CTCTTGGAAAGTTAGGTGTATGG + Intronic
956594084 3:70947658-70947680 CTCTTGTAATGTCAGAATTTTGG + Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
959339873 3:105115289-105115311 CTCTTGCAGTGTGACATGTATGG - Intergenic
959781913 3:110244147-110244169 TCCTTGCAATGTCAAAGGTAAGG + Intergenic
960460834 3:117933103-117933125 CTAGTGCAATGTCTGATATATGG + Intergenic
963972653 3:151446692-151446714 CTCTAGCAATGTCAGCTTTGGGG + Exonic
967211357 3:187172998-187173020 GTCTAGCAATGACAAATGTAGGG - Intronic
967528922 3:190527011-190527033 CTTTAGCTATGTCAGATGTATGG - Intronic
967617349 3:191586751-191586773 CTTCTGCAATATCTGATGTATGG + Intergenic
972445628 4:39140820-39140842 CATTTGCAATGTCACAAGTATGG - Intergenic
972745876 4:41932445-41932467 CTCTTCCTCTGTCAGATGTGTGG - Intergenic
975128230 4:70805890-70805912 CTATAGCAATGTCAGCAGTAAGG - Intronic
979602712 4:122603860-122603882 CTCTTGGTATGTAGGATGTAGGG + Intergenic
981066478 4:140491651-140491673 CTCTGGCAAAGGCAGAGGTAGGG + Intronic
981379118 4:144051438-144051460 CCTTTGCAATGTCAGATAAAAGG + Intergenic
982557985 4:156893070-156893092 ATATTGCAATGTCAAATATAAGG - Intronic
984748522 4:183248514-183248536 CGCTTCCAAAGTCACATGTATGG + Intronic
986918704 5:12659499-12659521 AGTTTGCAATGCCAGATGTAGGG - Intergenic
987779581 5:22416799-22416821 CTCTTTCAATTTCAGATGGCAGG - Intronic
991411299 5:66348041-66348063 CTATTGCACTGTCAGCTGGAAGG - Intergenic
992412883 5:76524296-76524318 GTCTTGAAAAGTCAAATGTATGG - Intronic
995174153 5:109155028-109155050 CTCTTGCCATGGCAAATGTAGGG - Intronic
1003168309 6:3700477-3700499 CTATTCCAATTTCAGAGGTAAGG + Intergenic
1013692270 6:112660014-112660036 CTCTTGCAATGGGTGATGCAAGG + Intergenic
1013764452 6:113558487-113558509 CTCCTGCAGTGGCAGATGTTGGG - Intergenic
1014520844 6:122440033-122440055 CTCTTGCTATGTGAGATGCCAGG + Intergenic
1016512102 6:144854922-144854944 CTCATGCAATGACAGAAGTGTGG + Intergenic
1018223901 6:161609151-161609173 CACTTGCAGTGTCAGAATTATGG - Intronic
1019946974 7:4337752-4337774 CTCTTTCAATTTAAGATGTCAGG + Intergenic
1020194968 7:6030386-6030408 CTCTTGCAAGGTCACGTGTCTGG - Intronic
1022399791 7:30026384-30026406 GTCTTGCGATGGCAGATGAATGG + Exonic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1040764903 8:50896711-50896733 CTCTAGTAATGACAGAGGTAGGG + Intergenic
1042826347 8:72984010-72984032 CTCTTGCACTGTCTGATGCAAGG - Intergenic
1044329019 8:90894513-90894535 TTCTTTCATTGTCAGATGTTGGG + Intronic
1048824472 8:138410384-138410406 CTCTTGCTTGGTCAGATGAAAGG + Intronic
1048934324 8:139342553-139342575 CTCTTGCAAAGTCAGGGGCATGG + Intergenic
1049878403 8:145043541-145043563 TTCTTGCAAGGTTAGATCTACGG + Intergenic
1050296040 9:4206385-4206407 CTCTTTCAAGGTTAGATGTTAGG - Intronic
1056334466 9:85552956-85552978 GTATTGAAATGTCAGATTTAGGG + Intronic
1061162822 9:128905362-128905384 CTCTTACAATGAAAGACGTATGG - Intronic
1061998669 9:134204681-134204703 ATCTTGAAATGTCACATGTGTGG - Intergenic
1192830299 X:74744235-74744257 CTTTTGCAATGCCAGATGTGAGG + Exonic
1195545821 X:106111480-106111502 CTCTTTCAATGTCAGTAGTGTGG - Intergenic
1197292029 X:124670332-124670354 CTCTTGTACTTTCAGATATAAGG + Intronic
1198236177 X:134737676-134737698 CCCATGCAATGTCAGAAGGAAGG - Intronic
1198713626 X:139532734-139532756 CTCTTTAAATGTCTGATATAAGG + Intronic
1198880695 X:141277888-141277910 CTGTTGCATTGTCAGAGGTCAGG - Intergenic
1201571985 Y:15424537-15424559 TTCTTTCAATGTCAGATGGCTGG + Intergenic